ID: 1122091013

View in Genome Browser
Species Human (GRCh38)
Location 14:99340572-99340594
Sequence CCTAAACTACAAAACCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122091007_1122091013 1 Left 1122091007 14:99340548-99340570 CCTAGATGTGAAAACGTCCCATA No data
Right 1122091013 14:99340572-99340594 CCTAAACTACAAAACCTGGATGG No data
1122091006_1122091013 25 Left 1122091006 14:99340524-99340546 CCTTCACTCTAGCACGACACTCA No data
Right 1122091013 14:99340572-99340594 CCTAAACTACAAAACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122091013 Original CRISPR CCTAAACTACAAAACCTGGA TGG Intergenic
No off target data available for this crispr