ID: 1122091430

View in Genome Browser
Species Human (GRCh38)
Location 14:99343453-99343475
Sequence GGTTCTGCACAGAGGCCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122091424_1122091430 -7 Left 1122091424 14:99343437-99343459 CCCACCCTACAAGGCCGGTTCTG No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091417_1122091430 9 Left 1122091417 14:99343421-99343443 CCTCCTCCCACCTCTTCCCACCC No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091414_1122091430 22 Left 1122091414 14:99343408-99343430 CCAGTCAGTCACCCCTCCTCCCA No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091420_1122091430 2 Left 1122091420 14:99343428-99343450 CCACCTCTTCCCACCCTACAAGG No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091415_1122091430 11 Left 1122091415 14:99343419-99343441 CCCCTCCTCCCACCTCTTCCCAC No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091419_1122091430 3 Left 1122091419 14:99343427-99343449 CCCACCTCTTCCCACCCTACAAG No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091425_1122091430 -8 Left 1122091425 14:99343438-99343460 CCACCCTACAAGGCCGGTTCTGC No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091418_1122091430 6 Left 1122091418 14:99343424-99343446 CCTCCCACCTCTTCCCACCCTAC No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091422_1122091430 -1 Left 1122091422 14:99343431-99343453 CCTCTTCCCACCCTACAAGGCCG No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data
1122091416_1122091430 10 Left 1122091416 14:99343420-99343442 CCCTCCTCCCACCTCTTCCCACC No data
Right 1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122091430 Original CRISPR GGTTCTGCACAGAGGCCTCA CGG Intergenic
No off target data available for this crispr