ID: 1122093091

View in Genome Browser
Species Human (GRCh38)
Location 14:99352878-99352900
Sequence GAGCACCCCGAGCATGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122093091_1122093100 6 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093100 14:99352907-99352929 GCGCGGGAACAGTGGGGAGGAGG No data
1122093091_1122093102 12 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093102 14:99352913-99352935 GAACAGTGGGGAGGAGGCCTGGG No data
1122093091_1122093103 15 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093103 14:99352916-99352938 CAGTGGGGAGGAGGCCTGGGAGG No data
1122093091_1122093097 -1 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093097 14:99352900-99352922 CGCGGGTGCGCGGGAACAGTGGG No data
1122093091_1122093099 3 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093099 14:99352904-99352926 GGTGCGCGGGAACAGTGGGGAGG No data
1122093091_1122093104 18 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093104 14:99352919-99352941 TGGGGAGGAGGCCTGGGAGGTGG No data
1122093091_1122093098 0 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093098 14:99352901-99352923 GCGGGTGCGCGGGAACAGTGGGG No data
1122093091_1122093105 23 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093105 14:99352924-99352946 AGGAGGCCTGGGAGGTGGACAGG No data
1122093091_1122093096 -2 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093096 14:99352899-99352921 TCGCGGGTGCGCGGGAACAGTGG No data
1122093091_1122093101 11 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093101 14:99352912-99352934 GGAACAGTGGGGAGGAGGCCTGG No data
1122093091_1122093095 -10 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093095 14:99352891-99352913 CGGGGTGCTCGCGGGTGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122093091 Original CRISPR GAGCACCCCGAGCATGTGCA CGG (reversed) Intergenic
No off target data available for this crispr