ID: 1122093103

View in Genome Browser
Species Human (GRCh38)
Location 14:99352916-99352938
Sequence CAGTGGGGAGGAGGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122093091_1122093103 15 Left 1122093091 14:99352878-99352900 CCGTGCACATGCTCGGGGTGCTC No data
Right 1122093103 14:99352916-99352938 CAGTGGGGAGGAGGCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122093103 Original CRISPR CAGTGGGGAGGAGGCCTGGG AGG Intergenic
No off target data available for this crispr