ID: 1122094783

View in Genome Browser
Species Human (GRCh38)
Location 14:99362968-99362990
Sequence CCTTATGCACACTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122094783_1122094790 -3 Left 1122094783 14:99362968-99362990 CCCAGCCCCAAGTGTGCATAAGG No data
Right 1122094790 14:99362988-99363010 AGGCTGAGGCTGAGAAGCCCTGG No data
1122094783_1122094792 13 Left 1122094783 14:99362968-99362990 CCCAGCCCCAAGTGTGCATAAGG No data
Right 1122094792 14:99363004-99363026 GCCCTGGTCTAGACCAAAGAGGG No data
1122094783_1122094791 12 Left 1122094783 14:99362968-99362990 CCCAGCCCCAAGTGTGCATAAGG No data
Right 1122094791 14:99363003-99363025 AGCCCTGGTCTAGACCAAAGAGG No data
1122094783_1122094795 23 Left 1122094783 14:99362968-99362990 CCCAGCCCCAAGTGTGCATAAGG No data
Right 1122094795 14:99363014-99363036 AGACCAAAGAGGGCATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122094783 Original CRISPR CCTTATGCACACTTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr