ID: 1122094838

View in Genome Browser
Species Human (GRCh38)
Location 14:99363194-99363216
Sequence ACCTGCCGCCTCGGGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122094838_1122094846 24 Left 1122094838 14:99363194-99363216 CCTGAGGTCCCGAGGCGGCAGGT No data
Right 1122094846 14:99363241-99363263 CCCATGCAATCAGCTCAGGAAGG No data
1122094838_1122094844 20 Left 1122094838 14:99363194-99363216 CCTGAGGTCCCGAGGCGGCAGGT No data
Right 1122094844 14:99363237-99363259 CTGTCCCATGCAATCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122094838 Original CRISPR ACCTGCCGCCTCGGGACCTC AGG (reversed) Intergenic
No off target data available for this crispr