ID: 1122098229

View in Genome Browser
Species Human (GRCh38)
Location 14:99386856-99386878
Sequence CCAGATCAGCCCATCCATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122098220_1122098229 8 Left 1122098220 14:99386825-99386847 CCCAAGGGGGGCACTTGCCCCAC No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data
1122098222_1122098229 -9 Left 1122098222 14:99386842-99386864 CCCCACCGATGTGCCCAGATCAG No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data
1122098219_1122098229 9 Left 1122098219 14:99386824-99386846 CCCCAAGGGGGGCACTTGCCCCA No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data
1122098221_1122098229 7 Left 1122098221 14:99386826-99386848 CCAAGGGGGGCACTTGCCCCACC No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data
1122098216_1122098229 20 Left 1122098216 14:99386813-99386835 CCTCTAGGCGCCCCCAAGGGGGG No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data
1122098218_1122098229 10 Left 1122098218 14:99386823-99386845 CCCCCAAGGGGGGCACTTGCCCC No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data
1122098212_1122098229 23 Left 1122098212 14:99386810-99386832 CCTCCTCTAGGCGCCCCCAAGGG No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data
1122098223_1122098229 -10 Left 1122098223 14:99386843-99386865 CCCACCGATGTGCCCAGATCAGC No data
Right 1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122098229 Original CRISPR CCAGATCAGCCCATCCATTT GGG Intergenic
No off target data available for this crispr