ID: 1122098385

View in Genome Browser
Species Human (GRCh38)
Location 14:99387864-99387886
Sequence GTCCACATGCATAATGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122098377_1122098385 27 Left 1122098377 14:99387814-99387836 CCTTCTTAAAAATAAGTGACCAC No data
Right 1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG No data
1122098383_1122098385 -9 Left 1122098383 14:99387850-99387872 CCTTCCAAGCATCTGTCCACATG No data
Right 1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG No data
1122098382_1122098385 -5 Left 1122098382 14:99387846-99387868 CCATCCTTCCAAGCATCTGTCCA No data
Right 1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG No data
1122098378_1122098385 8 Left 1122098378 14:99387833-99387855 CCACCCTGTGTTCCCATCCTTCC No data
Right 1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG No data
1122098381_1122098385 -4 Left 1122098381 14:99387845-99387867 CCCATCCTTCCAAGCATCTGTCC No data
Right 1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG No data
1122098379_1122098385 5 Left 1122098379 14:99387836-99387858 CCCTGTGTTCCCATCCTTCCAAG No data
Right 1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG No data
1122098380_1122098385 4 Left 1122098380 14:99387837-99387859 CCTGTGTTCCCATCCTTCCAAGC No data
Right 1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122098385 Original CRISPR GTCCACATGCATAATGTTGA TGG Intergenic
No off target data available for this crispr