ID: 1122100162

View in Genome Browser
Species Human (GRCh38)
Location 14:99402137-99402159
Sequence GACTGAAGACCTTTAGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122100162 Original CRISPR GACTGAAGACCTTTAGCATA GGG (reversed) Intronic
905678977 1:39853061-39853083 GACAGAAGACTTACAGCATAGGG + Intronic
907257042 1:53187406-53187428 GACTGAAGACCACTGGCCTAAGG + Intergenic
909192778 1:72574786-72574808 GAATGATGACCTTTATCAAATGG + Intergenic
915095801 1:153461259-153461281 GACCCAAGACCTATAGCACAGGG - Intergenic
918984512 1:191606948-191606970 GACTGAGGTCCTTTAACAAAAGG + Intergenic
920587998 1:207187231-207187253 GAGTATAGACCTATAGCATATGG - Intergenic
1068078107 10:52283392-52283414 GACTGAGGACTTTGAGCACAGGG + Intronic
1075358097 10:121802144-121802166 GACTGGAGAGCTTTGGCAAAAGG - Intronic
1077780458 11:5323215-5323237 GACTTAAGTACTTTACCATAGGG - Intronic
1078578053 11:12517812-12517834 CACTGAAGACGTTGAGCAGAGGG - Intronic
1078883921 11:15480908-15480930 GACAGATGAACTTTAGGATATGG - Intergenic
1080714059 11:34781198-34781220 GACTGGAGACCATTATCCTAAGG - Intergenic
1081419065 11:42850835-42850857 GAGTGAAGACTTCTAACATATGG + Intergenic
1087150919 11:94858914-94858936 AGCAGAAGACCTCTAGCATAAGG - Intronic
1088073143 11:105814134-105814156 GAATCAAGGCCTTTAGCACATGG + Intronic
1088905507 11:114152609-114152631 GAGTGAGGACCTGAAGCATATGG + Intronic
1089823984 11:121255719-121255741 TACTGAGGACCTTGGGCATATGG - Intergenic
1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG + Intronic
1102538937 12:113604220-113604242 CACTCAAGGCCTTTAGCAAAGGG - Intergenic
1105595942 13:21838112-21838134 GATTTAAGACCTTTAACATCAGG - Intergenic
1106909591 13:34449245-34449267 GGCAGTAGCCCTTTAGCATAAGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109117158 13:58402721-58402743 AACTGAAGACCATTATCCTAGGG - Intergenic
1109389262 13:61671364-61671386 GGCAGAAGCCCTTTAGCAGACGG - Intergenic
1120763566 14:88307811-88307833 CACTGAAGACCCTCAGCAAATGG + Intronic
1121889492 14:97575463-97575485 GACCAAAGACCTTGTGCATAAGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1125110352 15:36025262-36025284 GACTGGACACCTTTAGCATTAGG - Intergenic
1127992452 15:64130804-64130826 GACAGAAGACCCATAGCATGAGG + Intronic
1131983247 15:98016560-98016582 CACTGGAGACCATTAGCCTAGGG - Intergenic
1135856388 16:26014965-26014987 GAATACAGACCTTTTGCATAAGG + Intronic
1140255463 16:73332030-73332052 GTCTGAAGCCACTTAGCATAAGG - Intergenic
1154070981 18:11150691-11150713 GACTCAAGACAGTTGGCATATGG + Intergenic
1156575410 18:38309408-38309430 GACTGAATACCTTCAGAATCTGG - Intergenic
1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG + Intergenic
927617877 2:24618467-24618489 GTCTGAAGACCTTCAGCCAATGG + Intronic
933279128 2:80313187-80313209 CACTGAAGACCTGTTGCTTATGG - Intronic
936636262 2:114262005-114262027 GACTGTATACATTTAACATATGG + Intergenic
939674127 2:145050663-145050685 GCCTGAAGACCTTTAGTGTCTGG + Intergenic
939900140 2:147841713-147841735 GACTGAAAACCTTTGGAGTATGG - Intergenic
942444537 2:176069237-176069259 GACTGAGGACCTTGAGCCAAGGG + Intergenic
942903651 2:181154793-181154815 TTCTGAAGTCCTTTAGCGTATGG + Intergenic
1168844369 20:933638-933660 GACTGAATTTCTTTTGCATAGGG + Intergenic
1177741762 21:25162857-25162879 GCCTGAAGACATTTTTCATAAGG - Intergenic
1178100038 21:29258210-29258232 GACTAAAGAACTTTAGAATGTGG + Intronic
1182793768 22:32975436-32975458 GACTGACGACCTTAAGCTGATGG - Intronic
950110947 3:10418389-10418411 GAATGCAGACATTTAACATATGG + Intronic
951451385 3:22843196-22843218 AACTGAAGATATTTAGTATAAGG + Intergenic
951622440 3:24618260-24618282 GACTGAAATCTTTTAGAATAAGG - Intergenic
955564733 3:60231903-60231925 AACTGAAGGCCTTAACCATAGGG + Intronic
955733104 3:62008529-62008551 GATTGCAGACCTGTACCATATGG - Intronic
958068707 3:88580264-88580286 GACGTAACACCCTTAGCATAGGG - Intergenic
958779914 3:98528537-98528559 GACTGAGGACATCTAGAATAGGG + Intronic
959218933 3:103490507-103490529 CACTAAAGACCTTTATCATAAGG + Intergenic
960272225 3:115687797-115687819 GATTGAAGACCTTTTGAATTTGG - Intronic
965117647 3:164512809-164512831 CACTGAAGACCATTAGGTTAAGG - Intergenic
966423356 3:179755802-179755824 GATGGAAAACCTTTAGCAGAGGG - Intronic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
969101986 4:4776298-4776320 GGAAGAAGACCTTTAGCAAAGGG - Intergenic
969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG + Intronic
970848877 4:20577697-20577719 GACTGATGATCTATAGCACAGGG - Intronic
971189504 4:24413886-24413908 GATTAAAGACATTTAACATATGG - Intergenic
974390901 4:61266214-61266236 GTCAGAAAACCTTTAGAATACGG - Intronic
980617738 4:135253676-135253698 GACAGAAGAACATGAGCATAAGG - Intergenic
981496971 4:145404893-145404915 GATTGAAGCCATTTAGCACAGGG + Intergenic
981506646 4:145508205-145508227 GACTGAAGAATCTTATCATATGG - Intronic
982166603 4:152619092-152619114 GACTGAGCACCTTGAGGATAGGG - Exonic
982356784 4:154478580-154478602 GACACAAGAACCTTAGCATAGGG + Intronic
982598409 4:157414451-157414473 GCATGAATCCCTTTAGCATATGG + Intergenic
984548828 4:181136949-181136971 TACTGACGACCTTTACCATTAGG - Intergenic
987814142 5:22878995-22879017 GACTGAAGACTTCCAGCATCAGG - Intergenic
989123529 5:38028504-38028526 GACTTGAGACCTTTAGCAAATGG - Intergenic
989685937 5:44087372-44087394 GACTGAATTCCTTTACAATATGG - Intergenic
991244992 5:64501197-64501219 GACCAAAGAACTTTAGCATTGGG - Intergenic
994359669 5:98836119-98836141 GACTGAAGAGTTTCAGCATCAGG - Intergenic
997824207 5:137091821-137091843 GACTGAAAACTCTTTGCATATGG + Intronic
997834693 5:137182751-137182773 AAGTGAAGACCTTTAGCTCAGGG - Intronic
1000045412 5:157518199-157518221 GTCTGAAGACCTTTAGATTCTGG - Intronic
1004010257 6:11678591-11678613 GACTGATGAGTTTTAGCATTAGG - Intergenic
1005699844 6:28389399-28389421 CACTGCAGACTTTTAGCACAAGG - Intronic
1010095441 6:72037888-72037910 AACTGATGACCTTTAACATTTGG + Intronic
1011309447 6:85966049-85966071 AACTGATGAACTATAGCATAGGG + Intergenic
1011991798 6:93529917-93529939 GAATGAAGACATTAAGTATAAGG + Intergenic
1012324751 6:97903074-97903096 GAATGATGGCCTTGAGCATAAGG + Intergenic
1014544082 6:122712442-122712464 AACTGAAAACATGTAGCATAAGG + Intronic
1019037629 6:169074783-169074805 TTCTGAAGACTTGTAGCATAGGG - Intergenic
1019320489 7:413253-413275 GACTGCAGGCCTTGAGCATCTGG - Intergenic
1020587115 7:10082487-10082509 CACTGAAACCCTATAGCATATGG - Intergenic
1021262974 7:18481775-18481797 TAGTGTATACCTTTAGCATATGG + Intronic
1031134344 7:117869938-117869960 CACTGAAAACCCTTCGCATATGG + Intronic
1034131567 7:148722951-148722973 GACAGACGACCTTGAGCATGTGG - Intronic
1035691782 8:1563952-1563974 GTCTGAAGACCTTTTAAATATGG + Intronic
1037469379 8:19192509-19192531 GGCTGAAGAGCCTTAGCATTTGG - Intergenic
1039795241 8:40907314-40907336 CACTCAAGACCTTCAGCATCAGG - Intergenic
1043162847 8:76868265-76868287 GACAGAAAACCATTAGGATAAGG + Intergenic
1043684469 8:83069059-83069081 GACTTAACTCCTTTAGCACAAGG + Intergenic
1043916494 8:85928706-85928728 CACTGAAGACATTAAGCAAAAGG + Intergenic
1043919458 8:85964731-85964753 GACTGTAGACTTTTAGAGTAGGG - Intergenic
1045329112 8:101140308-101140330 CACTGGAGGCCTTTAGCACAAGG - Intergenic
1052232578 9:26172117-26172139 TAGTGAAGTCCTTTAGGATATGG - Intergenic
1052779692 9:32768282-32768304 GACTGAAGAGTTTTGGCATAAGG - Intergenic
1057479229 9:95431162-95431184 GTTTGAAGACCTTTAAAATAAGG + Intergenic
1058779947 9:108323369-108323391 GACTGAAGACCTATCATATATGG + Intergenic
1187291732 X:17961131-17961153 GACTGAAGATTTTAAGCAAAAGG - Intergenic