ID: 1122100901

View in Genome Browser
Species Human (GRCh38)
Location 14:99408926-99408948
Sequence GGGGTCCTTACAGCCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122100901_1122100909 4 Left 1122100901 14:99408926-99408948 CCTTCCAAGGCTGTAAGGACCCC 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1122100909 14:99408953-99408975 CTCAGCAAGGGCCTTCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 221
1122100901_1122100904 -8 Left 1122100901 14:99408926-99408948 CCTTCCAAGGCTGTAAGGACCCC 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1122100904 14:99408941-99408963 AGGACCCCACTGCTCAGCAAGGG 0: 1
1: 0
2: 1
3: 37
4: 195
1122100901_1122100910 13 Left 1122100901 14:99408926-99408948 CCTTCCAAGGCTGTAAGGACCCC 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1122100910 14:99408962-99408984 GGCCTTCTGGCAGGAGCCCCAGG 0: 1
1: 1
2: 4
3: 39
4: 336
1122100901_1122100908 0 Left 1122100901 14:99408926-99408948 CCTTCCAAGGCTGTAAGGACCCC 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1122100908 14:99408949-99408971 ACTGCTCAGCAAGGGCCTTCTGG 0: 1
1: 0
2: 1
3: 25
4: 180
1122100901_1122100903 -9 Left 1122100901 14:99408926-99408948 CCTTCCAAGGCTGTAAGGACCCC 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1122100903 14:99408940-99408962 AAGGACCCCACTGCTCAGCAAGG 0: 1
1: 1
2: 1
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122100901 Original CRISPR GGGGTCCTTACAGCCTTGGA AGG (reversed) Intronic
902989163 1:20174141-20174163 GAGGACCTCAGAGCCTTGGAAGG - Intronic
906376678 1:45302183-45302205 GGTGACCTTAGAGCCTTTGAAGG + Intronic
907393285 1:54172653-54172675 GGGGAACTTACAGCCTAGCAAGG - Intronic
910988277 1:93027730-93027752 GGGTTCCTTCCATCCTAGGAGGG - Intergenic
914351418 1:146843271-146843293 GCAGTCCTTCCATCCTTGGATGG - Intergenic
915330361 1:155107917-155107939 ATGCTCCTTCCAGCCTTGGAGGG + Intergenic
917734864 1:177911180-177911202 GGGGTCCTGCCAGACTTGAATGG - Intergenic
918737296 1:188081096-188081118 GGTTTACTTACAGCCTAGGATGG - Intergenic
921953204 1:220955362-220955384 GGGGCCCCTGCAGCCTTTGATGG + Intergenic
923069201 1:230547369-230547391 GGGGTCTGTGCAGCCTGGGAGGG - Intergenic
923233632 1:232011412-232011434 GGGGACCTTACAGCTTTTGCTGG + Intronic
1064859021 10:19804994-19805016 TGAGTCCTTACAGCCTTATAAGG - Intergenic
1067472343 10:46546284-46546306 GGGGTCCTGAATGCCATGGAAGG + Intergenic
1070688936 10:78510590-78510612 GGTGGCCTTGCAGCCGTGGAGGG + Intergenic
1071430851 10:85605549-85605571 GGGGTCCTTAAAGTCCTGAAGGG - Intronic
1079964445 11:26963998-26964020 TGGGTTCTTACAGCCCTGGCTGG - Intergenic
1081138082 11:39464109-39464131 GGTGTCCTTAGAGCCTAGAATGG - Intergenic
1084680209 11:70662473-70662495 CGGTCCCTTGCAGCCTTGGAAGG + Intronic
1084809331 11:71603060-71603082 GGGGTCCTAAGAGCCATGGGGGG - Intronic
1086699428 11:89883479-89883501 GTGATCCTCTCAGCCTTGGAAGG + Intergenic
1086706743 11:89961035-89961057 GTGATCCTCTCAGCCTTGGAAGG - Intergenic
1088234845 11:107712041-107712063 GGAGTCCAGACAGCCTGGGAGGG - Exonic
1088549415 11:110996159-110996181 TGGCTCATTACAGCCTTGCAAGG - Intergenic
1091239105 11:134040588-134040610 GGGGTCCATGCAGCCCAGGATGG + Intergenic
1091935878 12:4434208-4434230 TGGGTCCTTAGATCCTGGGAAGG + Exonic
1094514244 12:31118368-31118390 GGGGTCCTAAGAGCCATGGGGGG - Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1102192513 12:110999259-110999281 GGGGTCTTTTGAGCCTTAGAGGG - Intergenic
1104653098 12:130551754-130551776 TGGGTCTTTGCAGCATTGGAGGG - Intronic
1107046815 13:36001522-36001544 GGAGTCCTAGCATCCTTGGAAGG - Intronic
1107232051 13:38121554-38121576 AAGGTCCTTACAGCCTTAGATGG + Intergenic
1107940230 13:45376567-45376589 GGGGTCCTAAGAGCCTGGGGCGG + Intergenic
1107940620 13:45377958-45377980 GGGGTCCTAAGAGCCTGGGGCGG + Intergenic
1107941209 13:45380501-45380523 GGGGTCCTAAGAGCCTGGGGCGG + Intergenic
1107941818 13:45382518-45382540 GGGGTCCTAAGAGCCTGGGGCGG + Intergenic
1110252037 13:73391156-73391178 TAGGTCCTTACAACCTTGGAGGG - Intergenic
1110892289 13:80707216-80707238 GGGGTCCCAACAGCCTGGGGGGG - Intergenic
1113461626 13:110485969-110485991 GGGGTCCACACAGCCCTGGAAGG + Intronic
1113506054 13:110816685-110816707 GAGGCCCTTACAGGCTTGGCAGG + Intergenic
1121896933 14:97657458-97657480 GGGGTCTGCACAACCTTGGAAGG + Intergenic
1122100901 14:99408926-99408948 GGGGTCCTTACAGCCTTGGAAGG - Intronic
1122822156 14:104353173-104353195 TGGGTCCCTACAGGCCTGGAGGG - Intergenic
1125088642 15:35763672-35763694 GGGGGCTCTACAGCCATGGATGG + Intergenic
1131953454 15:97706190-97706212 GTGGAGCTTACAGCCTAGGAAGG + Intergenic
1131999572 15:98165172-98165194 GGGGCTCTGACAGCCTTGAAGGG - Intergenic
1132021088 15:98363398-98363420 GGGGTCCTTCCAGCATTTGCTGG + Intergenic
1132810401 16:1794185-1794207 GGGTTCCCTACAGCCTGGGTGGG + Intronic
1134692256 16:16198504-16198526 GGGGTGCTCACAGCCATGAATGG + Intronic
1134979594 16:18596173-18596195 GGGGTGCTCACAGCCATGAATGG - Intergenic
1137861309 16:51849504-51849526 GGGGTTTTTACAGACTTGTAGGG - Intergenic
1139982617 16:70872268-70872290 GCAGTCCTTCCATCCTTGGATGG + Intronic
1140976358 16:80063504-80063526 GGAGCCCTCACAGTCTTGGAGGG - Intergenic
1141737222 16:85861672-85861694 GGGCTCCTTCCAGCCTTCCATGG + Intergenic
1143410626 17:6706381-6706403 AGAGTCCTTGCAGGCTTGGAAGG - Intronic
1143981875 17:10877226-10877248 GGGGTCCTGCCACTCTTGGATGG + Intergenic
1144408105 17:14972421-14972443 AGTCTCCTTCCAGCCTTGGAAGG + Intergenic
1149632350 17:58136972-58136994 GGGGTCCTTAAATCCGTGCATGG - Intergenic
1150344756 17:64395802-64395824 GAAGTCCTTACAACCTTGAATGG + Intronic
1152257831 17:79250623-79250645 GAGGTCCTCAAAGCCTGGGAGGG - Intronic
1152818992 17:82426172-82426194 GGGGTACTTACAGGCCTGGACGG + Intronic
1157599327 18:48884546-48884568 GGGGTCCTTGCTGCCTGGCAAGG - Intergenic
1157728367 18:49982897-49982919 AGTGTCCTTAGAGCCTTGGAGGG + Intronic
1159023802 18:63165175-63165197 GGTATCCTTAGAGCCTTGCAGGG - Intronic
1159070876 18:63622719-63622741 GGGTTTCTTATACCCTTGGATGG + Intergenic
1162401963 19:10451886-10451908 GGGGTGCTTACAGCAGTGGGTGG + Intronic
1163493817 19:17633024-17633046 AGGGTGCTCACAGCCTTGGAGGG + Intronic
1163612881 19:18310166-18310188 GGGCTCCCTCCAGCCTGGGATGG + Intronic
1164645264 19:29854762-29854784 GGGGCGCCTACAGCCTTGGAAGG - Intergenic
1165797284 19:38526491-38526513 GGGGTCCATGGAGCCCTGGAGGG - Intronic
1167660331 19:50792355-50792377 GGTGTCCTTAAACCCTTGGCTGG - Intronic
1167851798 19:52207882-52207904 GGGGTCCTTAAACCCAGGGAAGG + Intronic
928202196 2:29255091-29255113 GTGGTCCTCGCTGCCTTGGATGG + Intronic
930771351 2:55133565-55133587 GGGTACCTTACAGCCTTGTGAGG - Intergenic
932060821 2:68495883-68495905 GGGGTCCTTTGAGCCATGGCTGG + Intronic
933994434 2:87657398-87657420 AGGGTCATTTCAGCCTTGCAGGG - Intergenic
936174182 2:110204760-110204782 GGGGGCGTTACAACCTGGGAAGG + Intronic
936299424 2:111293515-111293537 AGGGTCATTTCAGCCTTGCAGGG + Intergenic
936785309 2:116087567-116087589 GGGGTCCTTCCTGCCTTTGTAGG - Intergenic
938933234 2:136105606-136105628 GGAGTACTTATAGCCTAGGAAGG + Intergenic
942651505 2:178173883-178173905 GTGTTCCTTATAGCCTTGCAGGG + Intergenic
947674169 2:231962024-231962046 GGGGCCCTTGTAGCCTAGGATGG + Intronic
1169091372 20:2863143-2863165 GTGGGCATTACAGCCTTGGGTGG + Intronic
1169625700 20:7565896-7565918 GGGGTTCTTACAGCATGGCATGG - Intergenic
1172599077 20:36171280-36171302 GGGGAGCCCACAGCCTTGGAAGG - Intronic
1173593921 20:44247082-44247104 GGGCTCCTTCCACCCTTGCAGGG + Intronic
1175238195 20:57526906-57526928 GGGGTGCTTAGAGACTTGGGTGG + Intergenic
1175415864 20:58800583-58800605 GGGGTCCATGCAGCATGGGAGGG + Intergenic
1178154227 21:29832603-29832625 GGGGTCCTTTTAGCCATGGCTGG + Intronic
1180026829 21:45169275-45169297 GTTGTCCTTACAGCCTGGCACGG + Intronic
1180106015 21:45618593-45618615 GGGGGCCTCACATCCTGGGAAGG + Intergenic
1181370481 22:22411085-22411107 GGGCTCATTACAACCTTTGAGGG + Intergenic
1182122415 22:27796662-27796684 GGGGTCCTTTGAGGTTTGGAGGG - Intronic
1182304575 22:29358957-29358979 GGGGTCCTCACAGTCCTGGGGGG + Exonic
1185111691 22:48903671-48903693 GGGGCCCTCAGAGCCTTGGAGGG - Intergenic
1185318842 22:50190982-50191004 TGGGGCCTCACAGCCTTGGCAGG - Intronic
1185341673 22:50293799-50293821 GGGGCCCCTACAGCCCTGGCGGG - Intronic
949883478 3:8678538-8678560 GGGGTCCTAAGAGCCATGGAGGG - Intronic
949884076 3:8680974-8680996 GGGGTCCTAAGAGCCAGGGAGGG - Intronic
950053408 3:10008490-10008512 GGGGGGCTGACAGCCATGGAGGG + Intronic
950305046 3:11910775-11910797 GGGGGGCTGACAGCCATGGAGGG + Intergenic
950569480 3:13791123-13791145 GGCGTCCTCACAGGCTTTGAAGG + Intergenic
950888921 3:16385947-16385969 GGGGGTCTTGCAGCCTTGGAGGG - Intronic
951606963 3:24446178-24446200 GGCTTCCTTACATCCTTAGAAGG - Intronic
953769027 3:45764773-45764795 GGGGTGCATACTGCCTGGGAAGG + Intronic
954227220 3:49189923-49189945 GGTGTCAGTACAGCCATGGAAGG + Intronic
957076974 3:75609886-75609908 GGGCTCCTTAGAGCCAGGGAGGG + Intergenic
961768185 3:129228593-129228615 GGGGTCCTTCCTGCCCTGGAAGG + Intergenic
963515387 3:146301752-146301774 GGGGACCTCACAGCCCTGAAGGG + Intergenic
965047586 3:163598504-163598526 GGGGACCTCACTGCCTTGAAGGG + Intergenic
967194901 3:187017584-187017606 GGGGTCCATTTGGCCTTGGACGG + Intronic
969651105 4:8468879-8468901 GAGGTCCTTACAGCCCTGGCTGG - Intronic
969718525 4:8880286-8880308 GGGGTCCTGAAAGACTGGGAGGG + Intergenic
971454204 4:26828741-26828763 GGTTTCCTTACAGTCTTAGAAGG - Intergenic
976029992 4:80740927-80740949 GGGGACCTGACAGCCCTGAAGGG - Intronic
979916093 4:126435769-126435791 GGGTTTCTTACACTCTTGGAAGG + Intergenic
982378855 4:154726108-154726130 GGGGTCCTTCCAGAGTTGAAAGG - Intronic
983619734 4:169748082-169748104 GTGGTCATTATATCCTTGGAAGG - Intronic
985871382 5:2560095-2560117 GGGATCCTTACAGGCTTTCAGGG - Intergenic
987641049 5:20613094-20613116 GGGCTCCTTCCAGCTTTGGAAGG - Intergenic
992487123 5:77208601-77208623 GGTGTTCTTACAGGCATGGATGG + Intergenic
993809238 5:92455411-92455433 GGGGTCCTTAGTGTCTTGAAGGG - Intergenic
995568406 5:113455259-113455281 GGTGGCCTTTCAGCCTTGGCTGG - Intronic
998336230 5:141374711-141374733 CTGGTCCTTACTGCCATGGATGG + Exonic
1001045937 5:168371598-168371620 GTGGTTCTTCCAGACTTGGAGGG - Intronic
1001137653 5:169115850-169115872 GTGCTCCTGACAGCCATGGAAGG + Intronic
1001293728 5:170484513-170484535 GGGGAGCACACAGCCTTGGAGGG - Intronic
1002139904 5:177132508-177132530 GGGGTCCTCGCAGCCTCGGGCGG - Intergenic
1006084563 6:31586904-31586926 GGGGACTTTTCAGCCCTGGATGG - Intronic
1007237197 6:40399231-40399253 TGTGTCCTTCCAGCCTTGGATGG + Intronic
1008097524 6:47354689-47354711 GGGGTCCTTAGAGCATTTCATGG - Intergenic
1011603877 6:89083094-89083116 GGGATCCCTTCAGCCTGGGAAGG - Intronic
1015786486 6:136924092-136924114 CGGGTCCTTCCAGCCCGGGAAGG - Exonic
1018696855 6:166397362-166397384 GGGGTCCTCACAGCCCTGGTGGG + Intergenic
1035196621 7:157227051-157227073 GAGGTCTTTACAGCTTGGGATGG + Intronic
1036813679 8:11885651-11885673 AGGGTCCTTACCGCCATTGACGG - Intergenic
1038052588 8:23827590-23827612 GGGCTCAATTCAGCCTTGGATGG + Intergenic
1038903546 8:31871505-31871527 GGGGTTCTTACTGCCTGAGAGGG + Intronic
1039811799 8:41055481-41055503 GAGGTGCTTACAGCCTTTGTTGG - Intergenic
1042048143 8:64677918-64677940 GGGTTCCTTTAAGCCTTGGGAGG - Intronic
1049076284 8:140398989-140399011 TGGCTCCTTTCAGCCTTGGCTGG - Intronic
1049201085 8:141340983-141341005 GGGGTCCTTGCTTCCTTGTAGGG + Intergenic
1049499140 8:142952198-142952220 TGGGGCCTGAGAGCCTTGGATGG - Intergenic
1049586754 8:143435932-143435954 GGGGTCCTCAGAGCCCTGGCGGG - Intergenic
1050801266 9:9617721-9617743 GGTGTCCTCTAAGCCTTGGAAGG + Intronic
1053170023 9:35871926-35871948 GGGGTCCTCTCTGCCTAGGAAGG - Intergenic
1057048619 9:91904673-91904695 GGGATCTTTACAGCCTGGAAGGG - Intronic
1058937865 9:109785813-109785835 GTGGTACATCCAGCCTTGGAAGG + Intronic
1058939591 9:109800858-109800880 AGGATCCTAACTGCCTTGGAGGG + Intronic
1060113390 9:120922542-120922564 AGGGTCCTTCCAGCTTGGGAGGG + Intronic
1060235561 9:121860282-121860304 GGGGTCCTGACAGGCATGGGTGG - Intronic
1060328738 9:122644218-122644240 GGGGAGCTCACAGCCTTGAATGG + Intergenic
1060751046 9:126169757-126169779 GAGGTGCTTACAGGCTGGGAGGG + Intergenic
1187415053 X:19086234-19086256 GGGGTTCTTACATCATTGAAGGG + Intronic
1190614674 X:52217863-52217885 GGGGACCTCACTGCCTTGAAGGG + Intergenic
1193930342 X:87544390-87544412 GGGGACCTCACTGCCTTGAAGGG + Intronic
1194229650 X:91306628-91306650 GGGGACCTCACTGCCTTGAAGGG - Intergenic
1198817989 X:140613930-140613952 GGGGACCTTACTGCCTTGAAGGG - Intergenic