ID: 1122101828

View in Genome Browser
Species Human (GRCh38)
Location 14:99418563-99418585
Sequence TGCCACAGGCTGTCCTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122101828_1122101831 -2 Left 1122101828 14:99418563-99418585 CCTGGGCAGGACAGCCTGTGGCA 0: 1
1: 0
2: 2
3: 39
4: 317
Right 1122101831 14:99418584-99418606 CATCCTCCCTAGGCCCACTGTGG 0: 1
1: 0
2: 2
3: 20
4: 185
1122101828_1122101835 6 Left 1122101828 14:99418563-99418585 CCTGGGCAGGACAGCCTGTGGCA 0: 1
1: 0
2: 2
3: 39
4: 317
Right 1122101835 14:99418592-99418614 CTAGGCCCACTGTGGATCCATGG 0: 1
1: 0
2: 0
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122101828 Original CRISPR TGCCACAGGCTGTCCTGCCC AGG (reversed) Intronic
900882282 1:5390834-5390856 TTCCAGAGTCTTTCCTGCCCAGG - Intergenic
901272228 1:7961499-7961521 TGGCACAGTCCGGCCTGCCCCGG - Intronic
901399011 1:9003314-9003336 TCCCACAGCCTCTCCTGCCAAGG - Exonic
901492732 1:9604756-9604778 TGCCACATTCAGCCCTGCCCAGG + Intronic
902294082 1:15454369-15454391 TCCCACAGGCTTTCTGGCCCGGG - Intergenic
902334736 1:15748394-15748416 TGCCTCAGGCTGGCCTGGGCTGG + Intergenic
902337589 1:15762775-15762797 TGAGCCAGCCTGTCCTGCCCTGG + Intronic
902618751 1:17638374-17638396 TGCCCCAGGCTTCCCAGCCCTGG - Intronic
902794661 1:18793337-18793359 TGCCACCGCTTGTACTGCCCGGG + Intergenic
903695860 1:25206450-25206472 TGCCTCAGTGTGTCCTGCCAGGG - Intergenic
903813035 1:26045552-26045574 TGCCCCAGGCAGCCCCGCCCCGG - Intronic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
907722307 1:56983506-56983528 TGCTACAGGATGTCCTCCCCAGG - Intergenic
907722670 1:56986747-56986769 TGCAGCAGGATGTCCTCCCCAGG + Intergenic
908512797 1:64862645-64862667 TGCCCCATCCTGTCCTGTCCTGG - Intronic
909631551 1:77774182-77774204 TGCCACAGGATTCCATGCCCAGG + Intergenic
910451334 1:87349046-87349068 TAGGAAAGGCTGTCCTGCCCTGG - Intergenic
910910527 1:92229321-92229343 TGCCACAGGATTCCATGCCCAGG + Intronic
913159668 1:116133527-116133549 TGCCCCAGGATGTCTGGCCCAGG + Exonic
914093103 1:144521726-144521748 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914305423 1:146412158-146412180 TCCCAGAGGCTGCCCTGCACAGG - Intergenic
914596636 1:149160645-149160667 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914805556 1:150988707-150988729 TGCCACAGCCTATCCTGAGCAGG + Intronic
915092224 1:153434587-153434609 TACTACAGGCTGTCCTGCTGCGG - Intergenic
915294883 1:154913020-154913042 TGCCACCAGCTCTCATGCCCAGG - Intergenic
917442430 1:175079419-175079441 TGCGAGCGGCTGGCCTGCCCCGG + Exonic
918645943 1:186904612-186904634 TGTTACAGGCTGTGCTGCCAAGG - Intronic
920088555 1:203435719-203435741 TTCCCCAGGCTGGCCTGGCCTGG + Intergenic
920570193 1:207010636-207010658 GGGCACAGGCTGTCCTTCCTCGG - Intronic
923207868 1:231776138-231776160 GGTCACAGGCTGCCCTCCCCTGG - Intronic
1063231341 10:4068484-4068506 TGTCTAAGGCTGTCCTTCCCAGG + Intergenic
1064118814 10:12601956-12601978 TGCCACAGGATCCCTTGCCCTGG - Intronic
1064207495 10:13336332-13336354 TGGCACACGCTATCCTGCCCTGG + Exonic
1067225440 10:44373237-44373259 TGCCACAGCCTCCCCTGCCAGGG - Intronic
1067837401 10:49650080-49650102 TGCCCCAGGCCCTCCTGCCTGGG - Intronic
1069508654 10:69023543-69023565 TGCCACAGGATTCCATGCCCAGG - Intergenic
1069664690 10:70146500-70146522 CGCCTCGGGCTGTCCGGCCCGGG + Exonic
1070565207 10:77598783-77598805 AGCCACAGCCTGACCTTCCCAGG - Intronic
1070570970 10:77638796-77638818 TTCCACAGGCTGAGCTCCCCAGG + Intergenic
1072200122 10:93150618-93150640 TACCATATGCTGTCCTGGCCAGG + Intergenic
1074238975 10:111617408-111617430 TGGCATAGGCTCTCCTCCCCAGG - Intergenic
1075382448 10:122030433-122030455 TGACACAGGCTTTCATGCCCTGG - Intronic
1075495816 10:122917572-122917594 TCCCACAGGCTTCCCTTCCCAGG + Intergenic
1076133211 10:128028001-128028023 TGCCATGGCCTGTCCTGCCTTGG - Intronic
1076734756 10:132453614-132453636 TGCCACGGGCCGTCCCGCCCTGG - Intergenic
1076745307 10:132509960-132509982 TGTCACAGGTTGTCATTCCCTGG - Intergenic
1077134780 11:993072-993094 TGCCACACGCTGACCTGCCCTGG - Intronic
1077491320 11:2862304-2862326 CTCCACAGCCTGTCCTGGCCCGG + Intergenic
1078579274 11:12525976-12525998 TGCCACAGCCTGGCATGCTCAGG - Intronic
1079186608 11:18244033-18244055 TGCCACTGGTTGTCCTGTACAGG - Intronic
1081878959 11:46431362-46431384 AGCCCCTGGCTGTCCTGCCAAGG - Intronic
1083159959 11:60848681-60848703 TCCCACTGACTGCCCTGCCCTGG - Intronic
1083478858 11:62930658-62930680 TGCCACAGGGTGTCCTAGCTGGG + Intergenic
1084173875 11:67413439-67413461 AGCCATAGGCTGCCCTGCCTAGG + Intronic
1084553714 11:69863900-69863922 TCCCAGAGGCTGTCCTGCCGTGG - Intergenic
1088886499 11:114011636-114011658 TGCCACACCCTTTCCTGCCTCGG + Intergenic
1089185176 11:116610195-116610217 AGCCACAAGCTGTCCTACCAGGG + Intergenic
1089200776 11:116723657-116723679 AGCCACAGGCTCTCTTCCCCAGG + Intergenic
1089494538 11:118901639-118901661 TGCCACTGCCTGCCATGCCCAGG + Exonic
1090705007 11:129328157-129328179 TGCTTCAGGATGGCCTGCCCAGG + Intergenic
1092728374 12:11506245-11506267 AGCCACATGCTGTGCTGGCCTGG + Intergenic
1093619939 12:21277099-21277121 AGCCACAAGCTGTGCTGCCTGGG - Intronic
1093879115 12:24383541-24383563 TGTCCCACTCTGTCCTGCCCAGG + Intergenic
1095300171 12:40575064-40575086 TGGCACAGGTTGTGCTGCCTAGG - Intergenic
1095962587 12:47844728-47844750 CGCCACAGGCTGTCCTAGTCAGG + Exonic
1096676281 12:53227786-53227808 TGCTACAGTTTATCCTGCCCTGG + Intronic
1096813084 12:54183917-54183939 TGCCCCAGGCTTTCCTGCTGGGG - Exonic
1097079730 12:56421246-56421268 TGCCTGAGGCTGTTCTGACCAGG - Intronic
1097631625 12:62071278-62071300 AGCCACATGCTGACCTTCCCGGG - Intronic
1102204310 12:111079728-111079750 ACGCACAGGCTGTTCTGCCCTGG - Intronic
1102349048 12:112178891-112178913 GCCCACAGGCTGGGCTGCCCAGG + Intronic
1103884245 12:124188981-124189003 TCCCGCAGGCTCCCCTGCCCTGG + Intronic
1104050347 12:125190314-125190336 TGACACTGGCTGTCTTGGCCAGG - Intronic
1106078231 13:26479129-26479151 AGCCACAGGCTTTCCTTCTCAGG + Intergenic
1107815074 13:44237456-44237478 TGAGACAGGCTGTCCTGCCCAGG + Intergenic
1107818583 13:44266333-44266355 TTCCACAGACTGTCCTGCAGTGG - Intergenic
1107865171 13:44696281-44696303 TGCCAAAGACTTTCCTGCCCAGG + Intergenic
1108050077 13:46426491-46426513 TGCCCCACTCTGTCCTGCCCAGG + Intronic
1109542599 13:63799800-63799822 TGTCCCACTCTGTCCTGCCCAGG + Intergenic
1110253830 13:73409886-73409908 TGCCACACTCTGTCATCCCCAGG - Intergenic
1110748541 13:79085252-79085274 TGCCTCAGCCTGTTCTGCCCTGG - Intergenic
1110800013 13:79683829-79683851 TGCCACAGCCTGAACTGCCCTGG - Intergenic
1113295483 13:108954956-108954978 TGCCGCAGGATGCCGTGCCCAGG - Intronic
1113485657 13:110650656-110650678 TGACCCTGCCTGTCCTGCCCAGG - Intronic
1113784365 13:112994715-112994737 GGGCACAGGCTCTCCTGCCTGGG + Intronic
1113855910 13:113445417-113445439 TGCCACAGCCTGTCCTGGCATGG - Intronic
1114058701 14:18999665-18999687 TGCCACAGGATTCCATGCCCAGG - Intergenic
1114103843 14:19402089-19402111 TGCCACAGGATTCCATGCCCAGG + Intergenic
1118760466 14:68877910-68877932 GCCCACAGGCTGTCCAGCGCAGG - Intronic
1119159755 14:72443022-72443044 TGCTACAGGTTTTCCAGCCCTGG - Intronic
1119389741 14:74282905-74282927 TCCCACAGGCTGTAGTGCACTGG - Intergenic
1119784952 14:77306074-77306096 TGTCACCTGCTGCCCTGCCCCGG - Intronic
1120108801 14:80528185-80528207 TGCCACAAATTGTCCAGCCCTGG - Intronic
1121632659 14:95432410-95432432 CGCCCCAGGCTTTCCTGGCCCGG - Intronic
1122101828 14:99418563-99418585 TGCCACAGGCTGTCCTGCCCAGG - Intronic
1122792977 14:104192256-104192278 TTGCACAGGCCGGCCTGCCCTGG - Intergenic
1122803890 14:104247131-104247153 GGCCACAGGGTGCCCTGGCCGGG + Intergenic
1122834798 14:104425386-104425408 TGCTGCAGGGTGTCCTGCCCTGG - Intergenic
1122930958 14:104932935-104932957 TGCCAAACGCAGTCCTGGCCCGG - Exonic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1123703309 15:22931999-22932021 TGCCACAGGCTGTACCATCCAGG + Intronic
1124594832 15:31083679-31083701 TGCCACTGGAGGTCCTGGCCTGG + Intronic
1124604285 15:31159430-31159452 TGCCACTGGCCGTGCAGCCCGGG - Intronic
1126267081 15:46767439-46767461 AGCCACAGGGAGTCCTGCCAAGG - Intergenic
1126355829 15:47795123-47795145 TGAAACAGGGTGTCCTGCCTGGG + Intergenic
1129233585 15:74210014-74210036 TGCCAGAGCCAGGCCTGCCCAGG + Intronic
1129266362 15:74395605-74395627 TGCCACTGCCAGTCCTGCTCTGG - Intergenic
1130542885 15:84834763-84834785 CGCCATGGGCTGTCCTGGCCAGG + Intronic
1131889013 15:96952014-96952036 TGGCACAGACTCTCCTGCGCAGG - Intergenic
1132459159 16:41749-41771 TGGGACAGGCTTTCCTGCCTTGG - Intergenic
1132485347 16:187432-187454 TGCCACAGGCTGTCCCCTCCAGG - Intergenic
1132753645 16:1471191-1471213 CTCCACAGTCTGCCCTGCCCAGG + Intronic
1132826059 16:1906250-1906272 TGCACCAGGCTCTCCTGCCGGGG + Intergenic
1134052333 16:11145663-11145685 AGCCACCTGCTGTCCTGCCAGGG - Intronic
1136189343 16:28606485-28606507 TGCCAAAGGGTGTGCTACCCAGG - Intronic
1138454411 16:57113074-57113096 CTCCACAAGCTGTCCAGCCCTGG + Intronic
1139340451 16:66264772-66264794 TCCCGCTGGCTGTCCTGCCCGGG - Intergenic
1139379234 16:66520111-66520133 TCCCACAGGTTGGTCTGCCCTGG - Intronic
1139630997 16:68231868-68231890 TGGCACAGGCTGCACTGCGCAGG - Exonic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1141925507 16:87166186-87166208 TGCCACAGCCTGACCAGCTCTGG + Intronic
1142323460 16:89400005-89400027 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323470 16:89400043-89400065 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323482 16:89400081-89400103 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323493 16:89400119-89400141 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323504 16:89400157-89400179 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323515 16:89400195-89400217 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323526 16:89400233-89400255 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323537 16:89400271-89400293 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323548 16:89400309-89400331 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323559 16:89400347-89400369 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323570 16:89400385-89400407 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323581 16:89400423-89400445 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323592 16:89400461-89400483 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323604 16:89400499-89400521 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323615 16:89400537-89400559 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323627 16:89400575-89400597 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323639 16:89400613-89400635 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323650 16:89400651-89400673 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323662 16:89400689-89400711 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323674 16:89400727-89400749 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323685 16:89400765-89400787 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1142323697 16:89400803-89400825 TGCCCCAGGCTTCCCTGCGCTGG + Intronic
1143020945 17:3916954-3916976 TCCCACTGTCTGTCCTGCCGGGG + Intergenic
1143735552 17:8909789-8909811 TCCCACAACCTCTCCTGCCCTGG + Intronic
1144233391 17:13231730-13231752 TGCCACAGTGTCTTCTGCCCTGG - Intergenic
1144622294 17:16825117-16825139 AACCACAGGAGGTCCTGCCCGGG - Intergenic
1144884130 17:18447596-18447618 AACCACAGGAGGTCCTGCCCGGG + Intergenic
1145148099 17:20496781-20496803 AACCACAGGAGGTCCTGCCCGGG - Intergenic
1146264675 17:31444511-31444533 TGCCTCAGCCTGGTCTGCCCTGG + Intronic
1146661255 17:34666434-34666456 GCCCACAGGGTGTCCCGCCCAGG - Intergenic
1147196164 17:38768263-38768285 AGCCACAGGCTGCTCTGGCCAGG - Exonic
1147547952 17:41417719-41417741 TGACCCAGGCTGCTCTGCCCTGG - Intergenic
1147569720 17:41561708-41561730 TGCCCCACTCTGTCCAGCCCAGG + Intergenic
1148208935 17:45796536-45796558 GGAAACAGGCTGTGCTGCCCAGG + Intronic
1148245035 17:46024904-46024926 TCCCACAGGCTGCCCTGCAGAGG - Exonic
1148440699 17:47710394-47710416 TGCCACAGCCCTCCCTGCCCTGG + Intronic
1151974308 17:77475795-77475817 TGCCACCGGCTCCCCTGCCGTGG + Intronic
1152340662 17:79722363-79722385 GGCCAGGGGCTGGCCTGCCCAGG - Intergenic
1152621279 17:81366125-81366147 TGCCACAGCCAGGCCTGCCCTGG + Intergenic
1152624706 17:81382970-81382992 TGCCCCAGGCTGTAGTGCCTGGG - Intergenic
1153955055 18:10089037-10089059 TGCCCCTGGCTGTACTGCCCTGG + Intergenic
1156171739 18:34493982-34494004 TGCTGCAGGATGTCCGGCCCGGG + Intronic
1157413827 18:47485692-47485714 TGACACAGGTTGTCCATCCCAGG - Intergenic
1157533461 18:48441511-48441533 TGGCACAGGATGTCCGGCCGTGG + Intergenic
1157799612 18:50608849-50608871 GGCCACAGGGTCCCCTGCCCAGG - Intronic
1158477455 18:57792906-57792928 ACCCACAGGCTGTCCTGCCAGGG - Intronic
1158945361 18:62442802-62442824 TGCCACAGGATTCCATGCCCAGG - Intergenic
1159015501 18:63098988-63099010 TGTCTCAGGCTGTCCAGGCCTGG + Intergenic
1160354138 18:78212740-78212762 TGCCACATGGTGTCCTGGACAGG - Intergenic
1160390473 18:78527616-78527638 GGCCACACGGTGTCCAGCCCAGG + Intergenic
1161101503 19:2424157-2424179 AGCCACAGGCTCACCTGCCACGG - Exonic
1161400353 19:4064513-4064535 TGCCCCAGCCTGGCCTCCCCGGG + Intronic
1161724958 19:5923414-5923436 TGCCCCTGGCAGGCCTGCCCCGG + Intronic
1162299833 19:9838276-9838298 TGCCACAGGCTCTCCAGACGTGG - Intronic
1164627158 19:29737365-29737387 TGCCCCTGTCTTTCCTGCCCAGG + Intergenic
1164809262 19:31143166-31143188 TGCCACCTTCTGTCCTGTCCTGG + Intergenic
1165040149 19:33063324-33063346 TGCCCCACACTGTCCTGCCCAGG + Intronic
1166974922 19:46600485-46600507 TCCCACAGGCTGTCCTGGGATGG + Intronic
1167503437 19:49859723-49859745 AGACACAGCCTGGCCTGCCCAGG + Intronic
1168257794 19:55176065-55176087 TGCCACCTGCTGCCCTGGCCCGG + Exonic
1168713236 19:58513413-58513435 GCCCACAGGCTGTCCTGGGCAGG - Intergenic
925184475 2:1837605-1837627 TGCCACCTGGTGTCCTGTCCAGG - Intronic
925520994 2:4745875-4745897 AGTCACAGGCTGTCCTTGCCAGG - Intergenic
927468084 2:23351755-23351777 TGCCGCATGCTCTCCTGCCAGGG + Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
930600726 2:53440052-53440074 TGTCACAGACTGTGCTTCCCTGG + Intergenic
930872538 2:56183845-56183867 CGCTCCCGGCTGTCCTGCCCGGG - Intergenic
932091124 2:68807410-68807432 TTCACCAGGTTGTCCTGCCCAGG - Exonic
933158530 2:78999909-78999931 TGGCACAGGCTGTTCTGCTGTGG - Intergenic
933845486 2:86323102-86323124 TGCAAGAGGTTCTCCTGCCCTGG - Intronic
934793428 2:97081987-97082009 TGTCACAGGCTGGCCGGACCCGG - Intergenic
936255053 2:110904204-110904226 CACCACAGGCTTTCCTGCCAGGG - Intronic
938282496 2:130074552-130074574 TGCCACAGGATTCCATGCCCAGG + Exonic
938333125 2:130463124-130463146 TGCCACAGGATTCCATGCCCAGG + Exonic
938356686 2:130657547-130657569 TGCCACAGGATTCCATGCCCAGG - Exonic
938369971 2:130762694-130762716 TGGCACAGGCCGTCCAGCCCCGG - Exonic
938433122 2:131264353-131264375 TGCCACAGGATTCCATGCCCAGG - Exonic
938477169 2:131626936-131626958 TGCCACAGGATTCCATGCCCAGG - Intergenic
941688386 2:168471037-168471059 TGCCCCAGGCTGTCCACACCTGG + Intronic
942972322 2:181971508-181971530 TGCTACAAGCTGTGCTGCCTGGG + Intronic
945875320 2:215272184-215272206 TGCCACAGGAAGGCCTGGCCTGG + Intergenic
946027487 2:216680541-216680563 TGCCACCTGCCATCCTGCCCAGG - Intronic
946221301 2:218230008-218230030 TGCCCCAGGCTGTACTGCAGTGG + Intronic
946472862 2:219978881-219978903 TGACACAGCCTCTCTTGCCCTGG - Intergenic
946960042 2:224975392-224975414 TGACACAGGCTTTCTTTCCCAGG + Intronic
947152043 2:227125676-227125698 TTGCGCAGGCTGTCCTGTCCCGG + Intronic
947780966 2:232762808-232762830 TCTCCCAGGCTGTCCTGCCTTGG - Intronic
947866352 2:233400453-233400475 CGCCTCATGCTGTCCTGGCCTGG + Intronic
948711320 2:239827422-239827444 TGCCACAGGCTGCACGGCCTTGG + Intergenic
948846576 2:240685699-240685721 TGCCAGAGGCTGAGGTGCCCAGG - Intergenic
948847285 2:240689035-240689057 TGCCAGAGGCTGAGGTGCCCAGG + Intergenic
1169869610 20:10236892-10236914 TGACACAGACAGTTCTGCCCAGG - Intronic
1169988031 20:11469098-11469120 TGCCACCTACTGTCCTGTCCTGG - Intergenic
1170671137 20:18434752-18434774 TTTCACAGCCTGCCCTGCCCTGG - Intronic
1172499058 20:35412106-35412128 TGCACCAGGCTGTCGTGCCCGGG + Exonic
1172830817 20:37832885-37832907 TGCCACAGTCTGTGCTGTTCTGG + Intronic
1174322044 20:49749634-49749656 AGCCACTATCTGTCCTGCCCAGG - Intergenic
1175518190 20:59582376-59582398 TGTCACAGGCTGTGCTGCAGGGG + Intronic
1175545733 20:59776537-59776559 GGCCAGAGGCTCTCCTCCCCAGG - Intronic
1176115623 20:63430777-63430799 TGCCTCAGGGTCTCCTGCCCTGG - Intronic
1176231055 20:64033152-64033174 TGCCCCAGTCTGGCCTGTCCTGG + Intronic
1176388685 21:6152302-6152324 ACCCACAGGCTGTCCTGGCCAGG - Intergenic
1178138146 21:29651538-29651560 TGTCCCATGCTGTCCTGCCTGGG + Intronic
1178993260 21:37373199-37373221 TAGCACCGGCTGCCCTGCCCAGG + Intronic
1179023059 21:37657041-37657063 GGGGACAGGGTGTCCTGCCCTGG + Intronic
1179443247 21:41410878-41410900 TTCCACTGGCTGCCCTCCCCAGG - Intergenic
1179503031 21:41821708-41821730 TGACACAGGCTGGCCTTCCCAGG + Intronic
1179625392 21:42646289-42646311 CCCCACAGGGTGGCCTGCCCAGG - Intergenic
1179734787 21:43385946-43385968 ACCCACAGGCTGTCCTGGCCAGG + Intergenic
1179766686 21:43578920-43578942 TCCCAGAGGCGGTCCTGGCCGGG - Intronic
1179816388 21:43908962-43908984 TGTCACAGCCAGCCCTGCCCTGG + Intronic
1180011363 21:45053676-45053698 TTCCACAGTCTGCCCTGGCCAGG + Intergenic
1180477187 22:15722284-15722306 TGCCACAGGATTCCATGCCCAGG - Intergenic
1180693554 22:17737890-17737912 GGTTACAGGCTGTCCTGCTCGGG - Intronic
1181055098 22:20257137-20257159 TTCCCCAGGATGTCCAGCCCTGG + Intronic
1181485059 22:23225380-23225402 TGCGGCAGGCTGGCCAGCCCAGG + Intronic
1183740335 22:39665359-39665381 TGCCCCAGGGTGTTCAGCCCTGG + Intronic
1183910324 22:41074469-41074491 TGCCACAGGATTCCATGCCCAGG + Intergenic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1185067080 22:48637936-48637958 ATCCTGAGGCTGTCCTGCCCGGG + Intronic
1185070779 22:48654544-48654566 GACCCCAGGCTGTGCTGCCCAGG + Intronic
1185116346 22:48940419-48940441 TGCCTCAGGCTGTGCTTCCTGGG - Intergenic
1185182317 22:49370435-49370457 TCCCCCAGGCTGTGCTGCCGAGG + Intergenic
1185247219 22:49779626-49779648 AGCCACACGCTGAGCTGCCCTGG + Intronic
1185293621 22:50041538-50041560 TCCCAGAGGCTGCACTGCCCCGG + Intronic
1185366249 22:50438260-50438282 TGACACTCGCTGTGCTGCCCGGG + Exonic
949635052 3:5973556-5973578 TGCCACGGGGTTCCCTGCCCAGG - Intergenic
949668162 3:6365721-6365743 TGCCACAGAAAGTCATGCCCAGG + Intergenic
950128909 3:10528313-10528335 TGGCCCAGGCTCTCCTGGCCTGG - Intronic
953405198 3:42656504-42656526 TGTCCCAGGCTGTCCAGGCCTGG - Intronic
954453214 3:50582864-50582886 AGCCACTGGCTGCCCTGGCCTGG - Exonic
954709160 3:52496433-52496455 TCCCACAGGCAGTCCAGCCAGGG + Intronic
955783103 3:62507135-62507157 TGCCACAAGCTGTCTTGGGCGGG + Intronic
958944931 3:100352428-100352450 GGCCACAGCCTCTCCTGCCCGGG + Exonic
959904520 3:111695784-111695806 TCCCACAGGCCTTCCAGCCCAGG - Intronic
964763123 3:160153219-160153241 TTCCACAGGCTTTCCTGTTCTGG + Intergenic
966079071 3:175977796-175977818 TGCCACAGGATTTCATGCCCAGG + Intergenic
966515986 3:180821289-180821311 TGCCACAGGATTTCATGCCCAGG - Intronic
966525148 3:180912327-180912349 TGCCACAGAATGAACTGCCCAGG - Exonic
966938751 3:184731852-184731874 TGCCACAGGTTGGCCTCCCTTGG + Intergenic
968385533 4:133133-133155 TGCCACAGGCACTCCAGCCTGGG + Intronic
968518220 4:1023652-1023674 GGCCCCAGGCTCTCCTTCCCTGG - Exonic
968691325 4:1991897-1991919 TGGCAGAGGCTGTGCTGCTCAGG - Intronic
969469734 4:7380609-7380631 TGCCACAGGCAGTCTAGCCACGG - Intronic
969696331 4:8737236-8737258 TGTCACAGGAGGTTCTGCCCAGG + Intergenic
970866401 4:20763789-20763811 TGCCACAAGCAATCCTGCCTTGG + Intronic
971028879 4:22615544-22615566 GGCCACAGACCGTCCTGCCATGG + Intergenic
972560145 4:40219763-40219785 TGCTGCAAGCTTTCCTGCCCTGG - Intronic
975661872 4:76696579-76696601 TGTCATAGGCTGGCCTGGCCTGG + Intronic
978824669 4:113007311-113007333 GGCCACAGGCTGTGCTATCCTGG + Intronic
979889912 4:126078188-126078210 TGACACAGTCAGTCCTTCCCTGG - Intergenic
980085201 4:128383477-128383499 TGCCTCAAGCGGTCCTGCCCTGG - Intergenic
981677168 4:147355441-147355463 TGCCAGATGCTGACTTGCCCAGG - Intergenic
981710172 4:147701413-147701435 TGCTAAAGTGTGTCCTGCCCTGG + Intergenic
984044121 4:174776279-174776301 TGACACAGGCTGCATTGCCCTGG - Intronic
985040961 4:185891345-185891367 TGGGAAAGGCTGTCATGCCCAGG - Intronic
986331833 5:6722184-6722206 TGCCACAGGCTCTGCTTCACAGG - Intronic
986560309 5:9054086-9054108 TGCAACACGCAGCCCTGCCCAGG - Exonic
986758750 5:10860860-10860882 TGCCACAGGCTCTGGTGCTCTGG + Intergenic
986878409 5:12139445-12139467 TTCCTCATGCTTTCCTGCCCTGG - Intergenic
989169732 5:38462302-38462324 CGCCACAAGCTCTCCTCCCCTGG + Intronic
994316531 5:98339534-98339556 TGCCACAGGATTCCATGCCCAGG - Intergenic
997337465 5:133118373-133118395 TCCCACAGCCTGACCTGCCCTGG + Intergenic
997370816 5:133358496-133358518 TGCCAAGTGCTGTCCTCCCCAGG + Intronic
997435234 5:133869304-133869326 TGCGACGGGCTTTCCTGCCTGGG + Intergenic
998399910 5:141843265-141843287 TGCCCCAGGCTGGGCTGGCCAGG - Intergenic
998906557 5:146911592-146911614 TGCCACTGGCTATCCTAGCCAGG + Intronic
999197158 5:149790239-149790261 AGGCACAGGCTGCCCTTCCCAGG + Intronic
999288140 5:150406520-150406542 TGGCATAAGCTTTCCTGCCCAGG + Intronic
999327081 5:150650154-150650176 GGCTGCAGGCTGTCCTGGCCGGG - Exonic
1001454178 5:171848171-171848193 GGCCACCAGCTCTCCTGCCCCGG + Intergenic
1002493843 5:179598837-179598859 TGCCAGAGGCTCTCCTCTCCCGG - Intronic
1004654984 6:17651066-17651088 GGCCTCAAGCTGTCCTGCCTTGG - Intronic
1005504535 6:26458279-26458301 TGCCTCAGGCTGCCCGGCCTGGG + Intronic
1006250312 6:32777992-32778014 TGCTACAGGGAGTCCTCCCCAGG - Intergenic
1007777662 6:44232807-44232829 AGCCAGCGGCTGTCCTTCCCAGG - Exonic
1007985795 6:46205772-46205794 TGCCACAGGATTCCATGCCCAGG - Intergenic
1010474108 6:76264967-76264989 TGCCAGACCCTGTCCTGCCTTGG + Intergenic
1011698089 6:89931009-89931031 AGCCACTGGCTTTCCTGCCCAGG - Exonic
1013430742 6:110052854-110052876 TGCAACAGGGCGTCCTGTCCTGG - Intergenic
1013914058 6:115312774-115312796 TACTAGAGGGTGTCCTGCCCTGG - Intergenic
1015485394 6:133764295-133764317 TGCCACAGGCTGGCCTGAGCTGG - Intergenic
1018287542 6:162257057-162257079 AGCCTCAGCCTGTGCTGCCCCGG + Intronic
1019024810 6:168950625-168950647 TTGCACAGGCTGTGCAGCCCTGG + Intergenic
1019079200 6:169418040-169418062 TGCCAGAGGCCCTGCTGCCCTGG - Intergenic
1019387140 7:763648-763670 TGCCACAGGGAGCCCCGCCCAGG - Intronic
1019732409 7:2635239-2635261 TGGGTCTGGCTGTCCTGCCCCGG + Intronic
1021799064 7:24285532-24285554 TGCCTGATACTGTCCTGCCCTGG - Intronic
1022127522 7:27372627-27372649 TGCCTCAGGCCTTCCTCCCCTGG - Intergenic
1023028670 7:36074482-36074504 TGCCACAGGCTGACAGGGCCTGG - Intergenic
1025991946 7:66503554-66503576 TGCCACTGTCAGGCCTGCCCCGG - Intergenic
1027517667 7:79162989-79163011 TGCCATAGGGAGTCCTGCCAAGG + Intronic
1030346104 7:108434219-108434241 TTTCACAGTCTGTCCTGCCCTGG - Intronic
1030714936 7:112798696-112798718 TGCTAGAGGCTGTACTTCCCAGG - Intergenic
1032237647 7:130139332-130139354 TGAGACAGGCTGTGCTGCCCAGG + Intergenic
1032256859 7:130304501-130304523 TGCCGCAGACTTTCCTGACCTGG + Exonic
1032693823 7:134316538-134316560 GGGCTCAGGCCGTCCTGCCCCGG + Intronic
1033997414 7:147368235-147368257 TGTCACAGACTTCCCTGCCCAGG - Intronic
1034193070 7:149225716-149225738 AGCCTCAGGCTCTCCTGCCCTGG + Exonic
1034416263 7:150965768-150965790 TGCAACTGCCAGTCCTGCCCTGG - Intronic
1034879597 7:154753123-154753145 TGCCTCCTGCGGTCCTGCCCAGG + Intronic
1037588897 8:20296515-20296537 TGCCACAGATTGGCCAGCCCAGG + Intronic
1039642287 8:39237259-39237281 TTCCACTGGCTGTCCTCCCCAGG - Intronic
1039882020 8:41630933-41630955 TCCCACAGCCAGGCCTGCCCAGG + Intergenic
1042175708 8:66035523-66035545 TGTCACATGCTGTTCTGCCCTGG - Intronic
1043087295 8:75850060-75850082 TGCCACAGAGTGTGCAGCCCTGG + Intergenic
1047374189 8:124280736-124280758 AGCCACAGTCTTTCCTGCTCAGG + Intergenic
1047498711 8:125426771-125426793 TGCCACAGGTTGAACTCCCCAGG + Intergenic
1048990718 8:139758642-139758664 TGGCACAGGTCCTCCTGCCCTGG - Intronic
1049449834 8:142654704-142654726 TGCTTAATGCTGTCCTGCCCAGG + Intergenic
1049610592 8:143553102-143553124 TGCCAGACACTGTCCTGGCCTGG - Intergenic
1050561150 9:6835248-6835270 TGCCACAGGATTCCATGCCCAGG - Intronic
1051843875 9:21429927-21429949 TATCACAGGCTGCCCTGCACAGG + Intronic
1053415558 9:37944936-37944958 AGACACAGGCTGGCCTGGCCAGG + Intronic
1056569259 9:87801710-87801732 TGCCACAGCCAGTTCTGCTCCGG + Intergenic
1058084291 9:100732029-100732051 TGCCACAGGATTCCATGCCCAGG - Intergenic
1060237039 9:121871805-121871827 TGCCACTCACTGGCCTGCCCTGG + Intronic
1060479718 9:124011199-124011221 TGCCACAGGCCTGCCTTCCCGGG + Intronic
1060926866 9:127461319-127461341 ATCCACAGGCTGCCCCGCCCGGG + Intronic
1061489548 9:130937709-130937731 TGCCCCAGGCTGGGCTGCCAAGG - Intronic
1061933287 9:133844299-133844321 GTCCACAGGGTGTCCTTCCCCGG + Intronic
1062036553 9:134385115-134385137 CACAACAGGCTGCCCTGCCCAGG - Intronic
1062186616 9:135221849-135221871 TGACACAAGCATTCCTGCCCTGG + Intergenic
1062268568 9:135698674-135698696 GGCGACAGGCTGTCCAGCCCAGG + Intronic
1062364024 9:136200430-136200452 GGCCACAGGGTGCCCTGCCTGGG + Intronic
1062402781 9:136379722-136379744 GGCCACAGGCTGTGCTGCTTGGG + Intronic
1062441080 9:136570128-136570150 TGCCACCTGCTGTCAGGCCCAGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062589585 9:137267393-137267415 TGCCGTATGCAGTCCTGCCCAGG + Intronic
1189293740 X:39904259-39904281 GGTCACAAGCTTTCCTGCCCTGG - Intergenic
1190064894 X:47233140-47233162 CGCCACTGGCTGTCCAGGCCTGG - Exonic
1190739761 X:53281264-53281286 GGCCACAGGCTGTGCTGCTCAGG + Intronic
1200059860 X:153479417-153479439 TGCCGCAGGCTGTCCACCTCAGG + Intronic
1200184406 X:154172774-154172796 TCCCACAGGCTTTCCTGCGGGGG - Intergenic
1200190058 X:154209907-154209929 TCCCACAGGCTTTCCTGCGGGGG - Intergenic
1200195811 X:154247716-154247738 TCCCACAGGCTTTCCTGCGGGGG - Intergenic
1200201465 X:154284832-154284854 TCCCACAGGCTTTCCTGCGGGGG - Intronic
1200282781 X:154792207-154792229 TGCCCCAGGTAGCCCTGCCCAGG - Exonic