ID: 1122102658

View in Genome Browser
Species Human (GRCh38)
Location 14:99425614-99425636
Sequence TCTCGCTCTAAGCAAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122102653_1122102658 16 Left 1122102653 14:99425575-99425597 CCATAATCGCTTTGTACACGGCA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1122102658 14:99425614-99425636 TCTCGCTCTAAGCAAGGCACTGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122102658 Original CRISPR TCTCGCTCTAAGCAAGGCAC TGG Intronic
901600584 1:10420550-10420572 ACTTGCTCTAAGCCAGGCCCAGG + Intergenic
906095743 1:43222808-43222830 ACTCTCTCTGAGCCAGGCACAGG + Intronic
907784293 1:57596633-57596655 TCTTGCTCTAGGTGAGGCACTGG - Intronic
910296755 1:85654569-85654591 GCTTGCTCTAAGCAAGACAGGGG - Intronic
918122402 1:181551112-181551134 TCTAACTCTAAGCAAAACACAGG - Intronic
919527798 1:198676572-198676594 TCTATCTCTATGCAAGGCAATGG - Intronic
921661466 1:217808011-217808033 TCTCTCTCAAGGCATGGCACAGG + Intronic
921774406 1:219080578-219080600 TCTCCCTCTAAGGAGTGCACAGG - Intergenic
1063491561 10:6468990-6469012 TCTTGCTATATGCCAGGCACAGG - Intronic
1067016516 10:42759685-42759707 TCTCTCTCTAAACATGGAACGGG + Intergenic
1067201077 10:44172592-44172614 TCTACCTATAGGCAAGGCACAGG + Intergenic
1068693057 10:59937947-59937969 TCTAGGTCTATGCAAGGAACTGG - Intergenic
1069811263 10:71161616-71161638 TATCCCTCTCAGCAGGGCACTGG + Intergenic
1075498364 10:122948402-122948424 TCTTGCAGTAAACAAGGCACTGG - Intronic
1077512594 11:2976922-2976944 ACTGGCTCTAAGCAAGGGAAGGG - Intronic
1078492982 11:11786408-11786430 TCACTCTCTAAGTAGGGCACTGG + Intergenic
1080802730 11:35623008-35623030 TCTAGCGCTATGCAAGGCACTGG + Intergenic
1084368975 11:68725502-68725524 TCACCCTCTCAGCAAGCCACAGG - Intronic
1085258055 11:75188145-75188167 TCTCCCTCTAAGCAGAGCCCTGG + Exonic
1086336581 11:85807088-85807110 ACTTGCCCTAAGCAAGGCAGAGG - Intronic
1091928271 12:4373413-4373435 GCTCACTCTAAGGAACGCACTGG - Intronic
1092442423 12:8518181-8518203 TCACGCTGTAAGAGAGGCACAGG + Exonic
1096877783 12:54644159-54644181 TCTAGCTCTAAGGAAGTCCCAGG + Intergenic
1096896859 12:54829861-54829883 TCTGACTCTACGCAAGTCACAGG - Intergenic
1098845369 12:75528713-75528735 TCTCGATCTAAACAAGTCACAGG - Intergenic
1098927702 12:76369986-76370008 TCTCTCTCTACTCAAGGGACTGG - Intronic
1102873524 12:116432300-116432322 TGTTGCTAAAAGCAAGGCACCGG - Intergenic
1104670716 12:130678161-130678183 TCTGGCTCTAATCCAGGCAGAGG - Intronic
1106444440 13:29813218-29813240 TTTGGCTCTCAGCAAGGCAAAGG - Intronic
1107933524 13:45326051-45326073 TCACGGTCAAAGCAAGTCACAGG + Intergenic
1114068918 14:19093126-19093148 TCTCTCTCTAAACATGGAACAGG - Intergenic
1114093343 14:19306879-19306901 TCTCTCTCTAAACATGGAACAGG + Intergenic
1117216359 14:53556577-53556599 TCTCTCTCTAAGCAAAGAAATGG + Intergenic
1117779568 14:59218388-59218410 TCTCTCTCTAGGCTAGGAACAGG - Intronic
1122102658 14:99425614-99425636 TCTCGCTCTAAGCAAGGCACTGG + Intronic
1123063713 14:105605940-105605962 TCTCGCTCAGAGCAGAGCACTGG - Intergenic
1125761730 15:42100731-42100753 CCTTGCTGTAAGCAAGGGACAGG + Intergenic
1126380846 15:48045368-48045390 TATTGGTCAAAGCAAGGCACAGG - Intergenic
1127971613 15:63966468-63966490 TCTGGCTCCAAGCACAGCACAGG + Intronic
1131690393 15:94820865-94820887 TTTAGCTCTAATAAAGGCACAGG - Intergenic
1136720791 16:32318167-32318189 TCTCCCTCAATCCAAGGCACTGG + Intergenic
1138660886 16:58516186-58516208 ACTCGCTCTGAGGAAGACACAGG - Exonic
1138698918 16:58842441-58842463 TCTTGGTCTAAGCCAGGCTCAGG - Intergenic
1203005641 16_KI270728v1_random:199603-199625 TCTCCCTCAATCCAAGGCACTGG - Intergenic
1203137191 16_KI270728v1_random:1735723-1735745 TCTCCCTCAATCCAAGGCACTGG - Intergenic
1146413294 17:32608159-32608181 TTTTGCTCTAAGGAAGACACTGG + Intronic
1203164087 17_GL000205v2_random:78144-78166 TTTCCCTGTGAGCAAGGCACAGG + Intergenic
1166338604 19:42123466-42123488 TCTAGCTCTATGCTTGGCACTGG - Intronic
925013922 2:507576-507598 TCTGGCCCTAACCAAGCCACAGG - Intergenic
926089709 2:10042395-10042417 TCTCGCTCAGAGCAAAGCCCCGG + Intergenic
926972464 2:18480500-18480522 TCTCGTTCTCAGCCAGGCAGTGG - Intergenic
929444186 2:41989939-41989961 TCACGCTCTGAGCCAGGCTCAGG - Intergenic
941157998 2:162002158-162002180 TCTGGCTTTCAGCAGGGCACAGG + Intronic
941862613 2:170299506-170299528 ACTTGCTATAAGCCAGGCACTGG + Intronic
943216847 2:185047707-185047729 TTGCTCTCTAAGCAGGGCACTGG + Intergenic
944064482 2:195604329-195604351 TCTTACCCTAAGCAAGGCACAGG + Intronic
947688462 2:232112554-232112576 TCATGGTCTAAGCAAGGCCCTGG - Intronic
948330019 2:237157236-237157258 TCCCTCTCTAAGGAGGGCACGGG - Intergenic
1169115875 20:3065571-3065593 TCCCACTCTAAGCAAGGTAGGGG - Intergenic
1171388168 20:24784206-24784228 TCTAGTTAGAAGCAAGGCACAGG + Intergenic
1173199725 20:40945604-40945626 AGTCGCTGTAAGCTAGGCACTGG - Intergenic
1174477912 20:50810296-50810318 TATTGGTCTAAGCAAGTCACAGG + Intronic
1179464099 21:41560211-41560233 CCACGCTCTGGGCAAGGCACTGG + Intergenic
1180487390 22:15815686-15815708 TCTCTCTCTAAACATGGAACAGG - Intergenic
1182049732 22:27303508-27303530 TAACACACTAAGCAAGGCACTGG - Intergenic
1185117689 22:48947122-48947144 TTTTGCTCTCAGCAAAGCACTGG - Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
956773441 3:72546360-72546382 TCTTGTTCTATGCAAGGCCCTGG + Intergenic
957639166 3:82828204-82828226 TCTCTCTCTAAGCAAGAATCTGG + Intergenic
959022478 3:101203417-101203439 TCTTGCTGTATGCCAGGCACTGG - Intergenic
960167096 3:114415175-114415197 TCTCGCTGCAAACAAGGCATAGG + Intronic
961174059 3:124819802-124819824 TTTCTCTCCAAGCAAGGCAAGGG + Exonic
968710041 4:2107905-2107927 TCTTGCCATAAGCCAGGCACTGG + Intronic
976777731 4:88724207-88724229 TCTAGCTCCAGGCAGGGCACTGG - Intergenic
991255201 5:64605682-64605704 ACAAGCTCTAAGCAAGGCAAAGG + Intronic
991653459 5:68880218-68880240 TCTCTCTCTCTGCAAGGTACTGG - Intergenic
996251104 5:121333704-121333726 TCTTGGTCTACGCAAGGCAATGG - Intergenic
1015631268 6:135234195-135234217 TCTTGGTCTAAGCAGGCCACAGG + Intergenic
1017732205 6:157326624-157326646 TCTGGCACCAAGCAAGTCACAGG - Intergenic
1018447951 6:163875261-163875283 TCTCTCTTAGAGCAAGGCACCGG + Intergenic
1019868898 7:3740151-3740173 TCTGGCTCTAAGCAAGCAAGTGG - Intronic
1023558842 7:41451174-41451196 TCTCACTATGTGCAAGGCACTGG - Intergenic
1023648540 7:42344521-42344543 TCTCTCTCTAAACAAGGAAATGG + Intergenic
1027234517 7:76290258-76290280 TCTCACACTGAGCATGGCACTGG + Intergenic
1035686539 8:1527561-1527583 TCTCACTCTCAGAAATGCACTGG - Intronic
1036686368 8:10914218-10914240 TCCCGGTCTTAGCAAGGCAGGGG + Intronic
1037810175 8:22082145-22082167 TCCAGCACTAAGCCAGGCACCGG + Exonic
1039504292 8:38040808-38040830 TGTCGGTCAAAGCAAGTCACAGG + Intronic
1045490262 8:102662873-102662895 TCCCGGTCAAAGCAAGTCACAGG - Intergenic
1047427427 8:124759487-124759509 TCTAGCTCTGGGCTAGGCACCGG - Intergenic
1056382145 9:86065065-86065087 TCACGCTCTACGCTGGGCACAGG + Intronic
1056772969 9:89492878-89492900 TCTAGGGCTCAGCAAGGCACAGG + Intronic
1057695582 9:97320674-97320696 TCTCTGTGTAAGCCAGGCACTGG - Intronic
1188150518 X:26668751-26668773 ACTTACTCTAAGCAAGGGACTGG - Intergenic
1189076047 X:37915827-37915849 ACTTGCTCTAAGCAAAGCAAAGG + Intronic
1190733498 X:53239999-53240021 TCCAGCTCTATGCTAGGCACTGG - Intronic
1193257718 X:79368777-79368799 TCTGGCCCTAAGTAAGGCACAGG - Intergenic
1198642065 X:138767200-138767222 TCTTGGCCTCAGCAAGGCACTGG + Intronic
1200868992 Y:8076796-8076818 TGTCCCTGTAATCAAGGCACAGG + Intergenic
1201614133 Y:15877180-15877202 TCTGTCTCTATGCAAGGCAAAGG + Intergenic
1201616235 Y:15902597-15902619 TCTGTCTCTATGCAAGGCAAAGG - Intergenic