ID: 1122104566

View in Genome Browser
Species Human (GRCh38)
Location 14:99442481-99442503
Sequence GAAGAAAATCTATGTATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1681
Summary {0: 4, 1: 58, 2: 207, 3: 458, 4: 954}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122104566 Original CRISPR GAAGAAAATCTATGTATAAG TGG (reversed) Intronic
900377447 1:2362376-2362398 GAGGAAAACCTGTGTATGAGTGG + Intronic
900669898 1:3845238-3845260 GAAGTAAATCTATTTATAATGGG - Intronic
900912178 1:5606266-5606288 AAGGAAAATCCATGTATAAGTGG + Intergenic
902170416 1:14605735-14605757 GAAGAAAATTCACATATAAGTGG + Intronic
902492247 1:16791795-16791817 GAGGAAAATCTGTGTATAAGTGG + Intronic
903074302 1:20750656-20750678 GAAGAAAATCCACATATAAGTGG - Intronic
903355573 1:22745017-22745039 GAAGAAAGTCCAAGCATAAGTGG + Intronic
903410492 1:23139428-23139450 GAAGAAAATCCATCTGTAAATGG - Intronic
903556185 1:24195395-24195417 GAAGAAAATTCACATATAAGTGG + Intergenic
904801507 1:33096313-33096335 GAAGAAAATCCATGCATAAGTGG + Intronic
905346193 1:37312771-37312793 GAAGAAAATCTTACAATAAGGGG + Intergenic
905675917 1:39825028-39825050 GAAAAAAATCTGTGTCTAAGTGG + Intergenic
905753545 1:40487265-40487287 GAAAAAAGTCTATATAGAAGTGG - Intronic
905758746 1:40535439-40535461 CAAAAAAATCTGAGTATAAGTGG + Intronic
906027724 1:42688221-42688243 AAAAAAAATCTGTGTGTAAGTGG - Intronic
906229053 1:44145203-44145225 GAAGAAAATATAGTTATAAGTGG + Intergenic
906767450 1:48446910-48446932 GAAGAAAATTCGTGTATAAATGG - Intronic
906870009 1:49468124-49468146 GAAAACAATCTGTGTATAAGTGG - Intronic
907020644 1:51063761-51063783 GAAGAAGATCTGTGTATAAGTGG - Intergenic
907124840 1:52040698-52040720 GAAAAAAATCCACATATAAGTGG + Intronic
907166070 1:52412510-52412532 GTAGAAACGCTATGTATTAGAGG + Exonic
907674412 1:56505477-56505499 GAAGAAAATTTGTGTTTAAGTGG - Intronic
907839814 1:58145876-58145898 GAAGAAAATCTATGTGTAAGTGG - Intronic
907878957 1:58525307-58525329 AAAAAAATCCTATGTATAAGTGG + Intronic
908281468 1:62541425-62541447 GGAGAAAACCTACATATAAGTGG - Intronic
908565603 1:65352783-65352805 GAAGACAATCTTGGTAGAAGGGG + Intronic
908793458 1:67806370-67806392 GAAAAAAATCCAAGTAGAAGTGG - Intronic
908963050 1:69725308-69725330 GAAGAAAATCCACGTTTAAGTGG + Intronic
908997653 1:70176705-70176727 GAAAAAAATTTATATAAAAGTGG - Intronic
908997732 1:70177813-70177835 GAAGGAAATCCACATATAAGTGG - Intronic
909008472 1:70304853-70304875 GAAGAAAAACTAAGTAGAAAAGG - Intronic
909107773 1:71434077-71434099 AAAAAAAATCTATGTATAAGTGG - Intronic
909142566 1:71887291-71887313 GAAGAAAATCCAAGTATAAGTGG + Intronic
909282701 1:73775495-73775517 AAAAAAAATCCATGTATAAATGG - Intergenic
909292806 1:73905315-73905337 AAAGAAAATCCATGTGTAATTGG + Intergenic
909305992 1:74077570-74077592 GAAGAAAATATATTTCTAAAAGG - Intronic
909355109 1:74699471-74699493 GAACAAAATCTGCATATAAGTGG - Intergenic
909487354 1:76188867-76188889 GAAGAAAATCCACATATTAGTGG + Intronic
909532959 1:76701231-76701253 GAAGAAAATAAATTTAAAAGAGG + Intergenic
909614140 1:77587765-77587787 GAAGAAAATTTGTGTATAAGTGG - Intronic
909728287 1:78862858-78862880 GAAGAAAATCTAGGTAAGTGTGG - Intergenic
909816648 1:80002719-80002741 GAAGAAAATCCTAATATAAGTGG - Intergenic
909835355 1:80247855-80247877 GAAGAAAATTTAAGTATAAATGG + Intergenic
910052868 1:82996642-82996664 GAAGAAAATCCACATATAACTGG - Intergenic
910412208 1:86958493-86958515 GAAGAAAATTCTTGTGTAAGTGG + Intronic
910422829 1:87086349-87086371 GAAAAAAATCTATGTATGCATGG + Intronic
910456698 1:87405384-87405406 GAAAAAAATCTACATTTAAGTGG - Intergenic
910457891 1:87417399-87417421 GAAAAGAATCCATGTATAGGTGG + Intergenic
910781995 1:90948687-90948709 GAAAAAAATCCACGTTTAAGTGG + Intronic
910892054 1:92028805-92028827 GAAGAAAATCCATGTGTAAGTGG - Intergenic
911228909 1:95338951-95338973 GAAAAAAGTCTGTGTATAAGTGG + Intergenic
911315207 1:96348436-96348458 AAAAAATATCTGTGTATAAGTGG - Intergenic
911531376 1:99046956-99046978 GAGGGAAAACTATGTATAATAGG - Intergenic
911590570 1:99743356-99743378 AAAAAAAATCTGTATATAAGTGG - Intronic
912032045 1:105260604-105260626 GAAGAAAATCCACATATAAGTGG + Intergenic
912170545 1:107094091-107094113 GAAGAAAATCTGCATGTAAGTGG - Intergenic
912279141 1:108294892-108294914 GCAAAAAATCTTTGTATAAGTGG + Intergenic
912289085 1:108399465-108399487 GCAAAAAATCTTTGTATAAGTGG - Intronic
912326595 1:108769350-108769372 GAAAAAAATCTGCATATAAGTGG + Intronic
912539288 1:110400477-110400499 AAAGAAAATTCATGTGTAAGTGG - Intergenic
912937634 1:114017775-114017797 TAAGAAAAGCTATGAATAAAGGG + Intergenic
913127051 1:115801485-115801507 GAAGAAAATCTAAGTATAAGTGG - Intergenic
913206853 1:116546832-116546854 GAAGAAAATCCACATGTAAGTGG - Intronic
913235629 1:116779292-116779314 GAAAAAAATCTGCATATAAGTGG + Intergenic
913397678 1:118390075-118390097 AAAGAAAATCTGCATATAAGTGG - Intergenic
913446076 1:118952007-118952029 AAAGAAGATCTACATATAAGTGG - Intronic
914315157 1:146503876-146503898 GAAAAGAATCCATGTATAGGTGG + Intergenic
914329393 1:146652147-146652169 GAAGAAAATCCACATAAAAGTGG + Intergenic
914462092 1:147894505-147894527 GAAGAACACCTGTGTATAAGTGG - Intergenic
914499197 1:148229500-148229522 GAAAAGAATCCATGTATAGGTGG - Intergenic
914785077 1:150822196-150822218 GAAAAAAATCCATGTATAAGTGG + Intronic
914992266 1:152508997-152509019 GCACAGAATCTATTTATAAGTGG - Intergenic
915398425 1:155604180-155604202 GAAAAAGATCTGTGAATAAGTGG - Intergenic
915578619 1:156799359-156799381 GAAAAAAACCCATGTATGAGTGG + Intronic
915834114 1:159160784-159160806 AAAAAAAATCCATGTATAAGTGG + Intergenic
915852112 1:159335629-159335651 GAAAAAAATCCATGTATAAGTGG + Intergenic
916286754 1:163114633-163114655 GAAGAAATTATATGTAGTAGGGG - Intronic
916481392 1:165217714-165217736 GAAAAAAATCCACATATAAGTGG + Intronic
916726868 1:167531487-167531509 GAAGAAAATCCATGCATAAGTGG + Intronic
917071346 1:171154662-171154684 TGAAAAAATCCATGTATAAGTGG - Intronic
917229948 1:172824987-172825009 GAAGAATATCTCTCTGTAAGTGG + Intergenic
917547097 1:175982364-175982386 GAAGAAAATTTGCATATAAGTGG - Intronic
917566542 1:176218190-176218212 AAAAAAAATCCATGTATAAGTGG - Intergenic
917736734 1:177928078-177928100 GAATAAAATCCAAGTATAAGTGG + Intronic
917757131 1:178112951-178112973 GAAGAAAATCTTTGTGAAATTGG - Intronic
917824052 1:178797917-178797939 GAAAAAAATATGTGTATGAGTGG - Intronic
917824474 1:178802973-178802995 GAAAAAAATCTGTGTATGAGTGG + Intronic
917941327 1:179924863-179924885 AAAAAAAATCCATGTATAAATGG - Intronic
917994667 1:180423231-180423253 GAAAAACATCAACGTATAAGTGG + Intronic
918397449 1:184129331-184129353 GAAGAAAACCCACGTCTAAGTGG + Intergenic
918515139 1:185355153-185355175 AAAAAAAATCTGTGTATAAGTGG + Intergenic
918910725 1:190564994-190565016 TGAGAAAATCTATAAATAAGTGG + Intergenic
918999876 1:191816673-191816695 GAAGAAAATCCATGCCTAAGTGG - Intergenic
919035670 1:192305508-192305530 GAAAAAAATCTAAGTATAAGTGG - Intergenic
919154240 1:193741513-193741535 GAATAAAATCTACTTAAAAGTGG - Intergenic
919162149 1:193844157-193844179 GAAGAAAGTCTAAGTAAATGGGG + Intergenic
919191994 1:194232246-194232268 GAAGAAAATTCATGTATAAGTGG + Intergenic
919275867 1:195415987-195416009 GAAGAAAATTCATATATAAATGG + Intergenic
919314777 1:195957693-195957715 AAAAAAAGTCTATGTATAAATGG + Intergenic
919458985 1:197854472-197854494 GAAGAAAATCCAAGTATAAGTGG + Intergenic
919494313 1:198245246-198245268 GAAGAAAATCTACATATAAGTGG + Intronic
919507046 1:198412301-198412323 GAAGAAAATCCATGGATAAGTGG + Intergenic
919629563 1:199946917-199946939 GAAGAACAGCTATTTATAAGGGG - Intergenic
920151534 1:203912782-203912804 AAAAAAAATCTATGTATAAGGGG - Intergenic
920533524 1:206722638-206722660 GAAGAAAATCCCTGTATAAATGG + Intronic
920902862 1:210128829-210128851 GAAAACAATTTATGTATCAGTGG - Intronic
921128235 1:212196856-212196878 AAAAAAAATCTGCGTATAAGTGG + Intergenic
921155621 1:212436098-212436120 GAAGAAAACCCACATATAAGTGG + Intronic
921269425 1:213453866-213453888 GAAAAATATCCATGTATAAGCGG - Intergenic
921276723 1:213528067-213528089 AAAGAAAATCCATGTATAAGTGG + Intergenic
921484112 1:215696332-215696354 GAAGAAAAGCTATGGGTAAGTGG + Intronic
921494240 1:215817863-215817885 GAAGAAAATCTACATGTAAGTGG - Intronic
921543936 1:216451946-216451968 AAAGAAAATCCATGTATAAGAGG + Intergenic
921545566 1:216470721-216470743 GAAGAAAATCTACTTATAAGTGG + Intergenic
921618741 1:217303051-217303073 GAAGAGAATAGATGTCTAAGAGG - Intergenic
921680716 1:218027733-218027755 GAAGAAAATCTGTTTTTAGGGGG - Intergenic
921812631 1:219531908-219531930 GAAGAAAATCCACATAGAAGTGG - Intergenic
922055250 1:222036476-222036498 CAAGAAAATCAATGTCTATGAGG - Intergenic
922376303 1:224970753-224970775 GAAGAAAATGTACATATAAATGG + Intronic
922432558 1:225570374-225570396 AAAAAAAATCCATGTATAAGTGG - Intronic
922632096 1:227125788-227125810 GAAAAAAATCTGCATATAAGTGG + Intronic
922658525 1:227407701-227407723 GAAGAAAATCCACATATAGGCGG + Intergenic
922773551 1:228203958-228203980 CCAGAAAATCTGCGTATAAGTGG - Exonic
922854673 1:228764380-228764402 GAAAAAAATCTGTGTGTAAGTGG + Intergenic
922905073 1:229168164-229168186 TGAAAAAATCCATGTATAAGTGG + Intergenic
922960667 1:229643184-229643206 GAAGAAAACCCATGTATAAGTGG + Intronic
923053482 1:230405276-230405298 GAAGGAAATCCGGGTATAAGTGG - Intronic
923054149 1:230412786-230412808 GAAGAAAATCTGTGTATAAGTGG + Intronic
923113690 1:230914228-230914250 GAAGAAAATCCTCGTATAAGTGG - Intronic
923266736 1:232321618-232321640 GAAGAAAACCCACGTAGAAGTGG - Intergenic
923290753 1:232543344-232543366 GAAAAAAATATGTGTATAAGTGG - Intronic
923355157 1:233147587-233147609 AAAAAAAATTTATGTGTAAGTGG + Intronic
923399811 1:233605915-233605937 GAAAAATATCTATGTGTAAGTGG + Intergenic
923432071 1:233932342-233932364 TAAACAAATCTGTGTATAAGTGG + Intronic
923474834 1:234322587-234322609 GAAGAAAATCCACATGTAAGTGG + Intronic
923498975 1:234549094-234549116 AAAGAAAATCCATGCATAAGTGG - Intergenic
923528201 1:234790742-234790764 GAGGAAAATCTGTGTATAAGTGG - Intergenic
923546168 1:234924943-234924965 GATGGAAGTCTCTGTATAAGGGG - Intergenic
923615499 1:235533856-235533878 GAAGAAAATCCACATATAAGTGG - Intergenic
923683545 1:236138739-236138761 GAAGAAATTCTATATATTATAGG - Intergenic
923754400 1:236777502-236777524 GAAGAAAATCCCTGAATAAGTGG - Intergenic
923815041 1:237368131-237368153 GAAAAAAATCTGAGTATAAATGG + Intronic
923819793 1:237425793-237425815 AAGGAAAATGCATGTATAAGTGG + Intronic
923861441 1:237895813-237895835 GAAGACAACCTATGTATAAGTGG + Intergenic
923893068 1:238237107-238237129 GAAGAAAATCTGCATGTAAGTGG + Intergenic
924400803 1:243678885-243678907 GAAAAAAATCCATGTATAAGTGG - Intronic
924405687 1:243743283-243743305 GAAGAAAAACTTTGTATATAAGG + Intronic
924413174 1:243828477-243828499 GAAGCAAATCCAGGTACAAGTGG - Intronic
924550241 1:245069465-245069487 GAAGAAAATCCATGGAGAAGTGG + Intronic
924565537 1:245195264-245195286 TAAGAAAATATATGCATAATTGG - Intronic
1063343106 10:5286874-5286896 GAAAAAAATTCATGTATAAGTGG - Intergenic
1063644779 10:7868111-7868133 GGAGAAAATCCACATATAAGGGG + Intronic
1063818025 10:9799371-9799393 GAAAAATATCCATGTATAAGTGG + Intergenic
1063821623 10:9842959-9842981 AAAGAAAATCCATGTAGAAGTGG - Intergenic
1063883000 10:10550365-10550387 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1064036101 10:11914601-11914623 GAAGAAAATCCATGTGTAAGTGG - Intergenic
1064036462 10:11917378-11917400 GAAGAAAATCCATGTGTAAGTGG - Intergenic
1064237751 10:13592112-13592134 CCAGAAAAGCTGTGTATAAGAGG - Intronic
1064299789 10:14113234-14113256 GAAGAAAATTCACGTGTAAGTGG - Intronic
1064599052 10:16974713-16974735 GAAGAAAATCTGTGTTTAAGTGG - Intronic
1064859654 10:19814522-19814544 GAAGAAAATCCATGCAAAAGCGG + Intergenic
1064902094 10:20306411-20306433 GAAAAAAATCCACGTACAAGTGG + Intergenic
1064993267 10:21274994-21275016 GAAGAAAGTCCATGTGTAAGTGG + Intergenic
1065064533 10:21947303-21947325 GAAAAAAATCTGAATATAAGTGG - Intronic
1065320985 10:24509985-24510007 GAAGGAAATCTACATATAAGTGG + Intronic
1065446298 10:25805058-25805080 GAAGATAATCTATATATAAAAGG - Intergenic
1065572507 10:27085742-27085764 GAAGAAAATCCACATATAGGTGG - Intronic
1065648041 10:27857095-27857117 GAAGAAAATCCACATATAAGTGG - Intronic
1065707590 10:28484952-28484974 GGAAAAAGTCCATGTATAAGTGG + Intergenic
1065739089 10:28780653-28780675 GAAGAAAATCCTCATATAAGAGG + Intergenic
1065748324 10:28862168-28862190 GAAGAAAATCCACATATAAGTGG + Intronic
1066011567 10:31199089-31199111 TAAGAAAATCTACATATAATAGG - Intergenic
1066129756 10:32381418-32381440 AAACAAAATCTGTGTATAAGTGG + Intergenic
1066237126 10:33496302-33496324 GAAGAAAATCGATGTATAAGTGG + Intergenic
1066304581 10:34128233-34128255 GAAGAAACTCTGTGTATCAGTGG - Intronic
1066433364 10:35373539-35373561 TAAGAAAATCCATGTATAAGTGG - Intronic
1066547486 10:36516535-36516557 GAAGAAAATCCACATGTAAGTGG + Intergenic
1066648779 10:37636556-37636578 GAAGAAAATCTGTGTGTAAGTGG + Intergenic
1067031671 10:42882254-42882276 GAAGAAAATCTGTGTGTAACTGG + Intergenic
1067825342 10:49568092-49568114 GAAAAAAATCTGGGTGTAAGTGG + Intergenic
1067930711 10:50558644-50558666 GAAGAAAATCTGTGTATAAGTGG - Intronic
1068253292 10:54471310-54471332 GAAGAAAATCCACATATAAGTGG + Intronic
1068417302 10:56740471-56740493 GAAGAAAATCTGTGCATAGGTGG - Intergenic
1068505177 10:57891329-57891351 CAAGAAAGTCCACGTATAAGTGG + Intergenic
1068507420 10:57919381-57919403 GAAAAAAACCTATGTATAAGTGG - Intergenic
1068510051 10:57954360-57954382 GAAGAAAATCCAAGTGTAAATGG - Intergenic
1068850036 10:61727490-61727512 AGAGAAATTCTGTGTATAAGGGG - Intronic
1069612103 10:69780899-69780921 GAAGAAAATCTGCTTATAAGTGG - Intergenic
1070353782 10:75619227-75619249 GAAGAAAATCCATGTACAAGTGG + Intronic
1071250428 10:83813241-83813263 GAAAGAAAGCTACGTATAAGTGG - Intergenic
1071816389 10:89235960-89235982 AAAAAAAATCCATGTATGAGTGG - Intronic
1071861961 10:89683439-89683461 GAATAAAATCCACATATAAGTGG - Intergenic
1071925389 10:90401986-90402008 GTAGAAAATATTTGTATATGTGG - Intergenic
1072440860 10:95453712-95453734 GAAAAAAATCTACATATAAGTGG - Intronic
1072557758 10:96536621-96536643 GAAGAAAATCCACTTGTAAGTGG - Intronic
1072642047 10:97219037-97219059 GAAGAAAATCTGCTTGTAAGTGG - Intronic
1073558039 10:104472399-104472421 GAAAAAGGTCTACGTATAAGAGG - Intergenic
1073917272 10:108420083-108420105 AAAGCAAAACTATGGATAAGGGG + Intergenic
1073963952 10:108966841-108966863 GAAAAAAATCCATGTATAAGTGG - Intergenic
1074010056 10:109469164-109469186 GGAGATCATCCATGTATAAGTGG - Intergenic
1074107201 10:110397396-110397418 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1074179036 10:111041089-111041111 AAAGAAAATCTGCATATAAGTGG + Intergenic
1074322807 10:112418904-112418926 GAAGAAAATCCACCTATCAGTGG + Intronic
1074379585 10:112968246-112968268 GAAGAAAATCCATGTCTAAGTGG - Intronic
1074570849 10:114622693-114622715 GAAGAAAATCTGTGTGCAAGGGG - Intronic
1074692823 10:116021991-116022013 AAAAAAAATCCATGCATAAGTGG - Intergenic
1074770365 10:116729697-116729719 GAAAAAAATCCATGGATAAGTGG + Intronic
1074969609 10:118525220-118525242 AAAAGAAATCCATGTATAAGTGG + Intergenic
1074991147 10:118709249-118709271 GGAGAAAATCCGTGGATAAGTGG + Intronic
1075118856 10:119649945-119649967 AAAAAAAATCCATGTACAAGTGG + Intergenic
1075183023 10:120229069-120229091 GAAGAAAATCCATGTATAAGTGG + Intergenic
1075238173 10:120751040-120751062 GATGAAAATATAAGTATAAAAGG - Intergenic
1075720445 10:124583008-124583030 GAAGAAAAACTGCATATAAGTGG + Intronic
1076091356 10:127689093-127689115 GAAGGAAATCCAAGTATGAGTGG + Intergenic
1076098916 10:127758137-127758159 GAAGAAAATCCATGTATAAATGG - Intergenic
1076312485 10:129518413-129518435 GAAGAACATCTAAGTGTAAGTGG - Intronic
1077165883 11:1138110-1138132 GAAAAAACTCCATGCATAAGAGG + Intergenic
1077848368 11:6049970-6049992 TAATAAAATCTATGTAGCAGAGG - Intergenic
1078254687 11:9647949-9647971 GAAGAAAATCTGCATTTAAGTGG + Intergenic
1078362825 11:10682661-10682683 CAAGAAATTCTCTGTATATGGGG + Intronic
1078434406 11:11312561-11312583 GAAGAAAATTTGTATCTAAGTGG + Intronic
1078477843 11:11647997-11648019 GAAAAAAATCCATGTATAAATGG - Intergenic
1078785398 11:14486086-14486108 AAAAAAAGTCCATGTATAAGTGG + Intronic
1078804354 11:14682210-14682232 GAGGAAAATCCACATATAAGTGG + Intronic
1078906130 11:15689522-15689544 GAAGAAAATCCACCTATCAGAGG - Intergenic
1079227838 11:18623192-18623214 GAAAAAAATCCATGTATAAGTGG + Intronic
1079449622 11:20588498-20588520 GAAGAAAACCCATGTATAAGTGG + Intergenic
1079584577 11:22110143-22110165 GAAGAAAATCCTTGTATAAGCGG + Intergenic
1080073341 11:28115780-28115802 GAAGAAAATCCACAAATAAGTGG + Intronic
1080153911 11:29085161-29085183 GAAGAAAATCCACATATAAGTGG + Intergenic
1080272486 11:30465758-30465780 GAAAAAAATCCGTGTATAAGTGG - Intronic
1080321671 11:31017216-31017238 GAAGAAAATCTGCATGTAAGTGG - Intronic
1080955946 11:37095531-37095553 AAAAAAAATCTACATATAAGTGG - Intergenic
1081222813 11:40483018-40483040 GAAGAAAATATAGGTAAATGGGG - Intronic
1081922072 11:46787838-46787860 GAAGAAAATTCATGCATAAGTGG - Intronic
1081942703 11:46957986-46958008 AAAGAAAATCTGTGTATAAGTGG - Intronic
1082171713 11:49012776-49012798 GAAAAAAATCCACTTATAAGTGG - Intergenic
1082211766 11:49512373-49512395 GAAGAAAATACACATATAAGTGG - Intergenic
1082682868 11:56199839-56199861 TATGAAAATCAATGTAAAAGTGG - Intergenic
1082932855 11:58626969-58626991 AAGGAATATGTATGTATAAGAGG + Intergenic
1084495909 11:69502993-69503015 GAAGAAAATCCACATGTAAGTGG + Intergenic
1085027710 11:73246647-73246669 GAAGAAAATCTGCATATATGTGG - Intergenic
1085839228 11:79991795-79991817 GAAGAAAATCTATCTCAAAGTGG + Intergenic
1085955509 11:81388832-81388854 GAAAAAAATTTATATATAAGTGG - Intergenic
1086008797 11:82073167-82073189 GAAGAAAAATAATGTAAAAGAGG - Intergenic
1086521467 11:87672911-87672933 AAATAAAATCCATGTAAAAGTGG + Intergenic
1086566911 11:88237670-88237692 GAAGAAAATATGCATATAAGTGG - Intergenic
1086637869 11:89112447-89112469 GAAGAAAATACACATATAAGTGG + Intergenic
1086694057 11:89823173-89823195 GAAAAAAATCCACTTATAAGTGG + Intergenic
1086712090 11:90021396-90021418 GAAAAAAATCCACTTATAAGTGG - Intergenic
1086722681 11:90140543-90140565 GAAAAAAATTCATATATAAGTGG + Intronic
1086872233 11:92052150-92052172 GAAGGAAATCCACGTACAAGTGG + Intergenic
1086965382 11:93021755-93021777 GAAAAAAATGTATGTATAAGTGG - Intergenic
1087058140 11:93953208-93953230 GAAGAAAATTCACATATAAGTGG - Intergenic
1087126394 11:94630422-94630444 GAAGAAAATCCATGTTTAAGTGG + Intergenic
1087172420 11:95063338-95063360 AAAAAAAATCCCTGTATAAGTGG - Intergenic
1087252416 11:95917838-95917860 GAAGAAAATCCACATAAAAGTGG + Intronic
1087346038 11:96972406-96972428 AAAGAATATCTATGCATATGAGG - Intergenic
1087427449 11:98008593-98008615 TAAGAAAATCTCTGTATACATGG - Intergenic
1087939381 11:104076738-104076760 AGAGAAAATCCATGTGTAAGTGG - Intronic
1088208358 11:107422204-107422226 GAAAAAAATCTGTGTATAAGTGG - Intronic
1088664084 11:112076738-112076760 GAAGAAAATCTGAGGATAAGTGG + Intronic
1088696284 11:112368775-112368797 GAACAAAATCTGTGTAAAAGTGG - Intergenic
1088846027 11:113668812-113668834 GAAAAATATCTGTGTATAAGTGG - Intergenic
1089029612 11:115311549-115311571 GAAAAAAATCCAGGTATAAATGG + Intronic
1089100755 11:115960325-115960347 GAAGAAAATCCATGTATAAGTGG + Intergenic
1089914070 11:122135232-122135254 GAAGGAAATCTGCTTATAAGTGG - Intergenic
1090223612 11:125054102-125054124 GAAAAAAATTTATGTTTCAGTGG - Intergenic
1090681064 11:129057713-129057735 AAAAAAAATCTGTGTATTAGTGG + Intronic
1090760312 11:129831591-129831613 AAAGCAAATCCATGGATAAGGGG + Intronic
1091009982 11:131992074-131992096 GAAGAAAATCTGTGTATAAGTGG - Intronic
1091078927 11:132647736-132647758 GAAGAAAATTCACATATAAGTGG + Intronic
1091235344 11:134018484-134018506 GAAGAATATGTATGTGTAAGTGG - Intergenic
1091268537 11:134289424-134289446 GAAAAAAATCCGAGTATAAGTGG + Intronic
1091340511 11:134808995-134809017 TAAAAAAATCCATGTATAAGGGG + Intergenic
1091411385 12:242200-242222 GGAGAAAATCCACGTATAAGTGG - Intronic
1092397206 12:8137773-8137795 GAAAAAACTCTATTGATAAGTGG + Intronic
1092812077 12:12280901-12280923 GAAAAAAGTTCATGTATAAGTGG + Intergenic
1092822356 12:12364527-12364549 GAAGAAAATCTACGTATAAGTGG + Intronic
1092932767 12:13332619-13332641 GAAGAAAATCTGTGTATAAGTGG - Intergenic
1092981813 12:13802931-13802953 GAAGAAAATCTGTGTGTAAGTGG - Intronic
1093125258 12:15321768-15321790 GAAGAAAATCTGCATATAACTGG + Intronic
1093163826 12:15782134-15782156 GAAAAAAATCTGTGTATAAGTGG - Intronic
1093327353 12:17794355-17794377 GAAGAAAATCTGCATCTAAGTGG + Intergenic
1093588017 12:20865582-20865604 TCAAAAAAACTATGTATAAGTGG - Intronic
1093612653 12:21181757-21181779 GAAAAAAGTCTGTGCATAAGTGG - Intronic
1093698408 12:22189683-22189705 GAAGAAAATCCTCATATAAGTGG - Intronic
1093732543 12:22582290-22582312 GAAGAAAATCCATATATAATTGG + Intergenic
1093843288 12:23933071-23933093 AAAGCAAAACTATGTAAAAGGGG - Intronic
1094088128 12:26616759-26616781 AAAGAAAATCTGTGTATAAGTGG - Intronic
1094170576 12:27487210-27487232 GGAGGAAATATATGTATAAAGGG - Intronic
1094199744 12:27783316-27783338 GAAGAAAATCTGAATGTAAGTGG + Intronic
1094279375 12:28718460-28718482 GAAGAAAACGTATGTATAGGTGG + Intergenic
1094609174 12:31976839-31976861 AAAGAAAATCCACGTATAAGTGG + Intronic
1094663007 12:32489589-32489611 GAGGAAAGTTTATGTATAAAAGG + Intronic
1095279599 12:40334717-40334739 GAAGAAAATTTATGTATATGTGG + Intronic
1095471735 12:42544111-42544133 GAAGAAAATCCACATATAAATGG + Intronic
1095661364 12:44741045-44741067 AACGAAAATCCATGAATAAGGGG - Intronic
1095937079 12:47696496-47696518 GAAAAAAATCTACATTTAAGTGG - Intronic
1096068215 12:48757998-48758020 AAAGAAAAACTATATATATGTGG + Intergenic
1096899558 12:54861244-54861266 GAAAAACATCTGTGTGTAAGTGG + Intergenic
1096922710 12:55105142-55105164 GAAGTAAATATGTTTATAAGAGG + Intergenic
1096990073 12:55793630-55793652 AAAAAAAATCCAAGTATAAGTGG + Intronic
1097332589 12:58348063-58348085 GAAAAATATCCATGTATAAATGG - Intergenic
1097413145 12:59280751-59280773 GAAGAAAATCTACATATAAGTGG + Intergenic
1097467618 12:59947500-59947522 AAAGAAAAAAGATGTATAAGAGG + Intergenic
1097893446 12:64801160-64801182 CCAGAAAATCTATGTCTAATGGG - Intronic
1098075987 12:66732092-66732114 AAAAAAAATCTACATATAAGTGG - Intronic
1098266581 12:68727876-68727898 GAAAAAAATTTATGCAGAAGTGG + Intronic
1098365231 12:69695765-69695787 TAAAAATATCTATATATAAGAGG + Intronic
1098582314 12:72114627-72114649 GAAGAAAATCCATGTATAAGTGG + Intronic
1098603176 12:72358232-72358254 GAAGAAAATTCATGTATAAGGGG - Intronic
1098734692 12:74084549-74084571 AAAAAAAATCTGAGTATAAGTGG + Intergenic
1098768886 12:74526670-74526692 TAAGAGCATCTATGTTTAAGTGG + Intergenic
1098800474 12:74950988-74951010 AAAGAAAATCCACATATAAGTGG - Intergenic
1098815343 12:75153989-75154011 GAAAAAAAACTATGTATAAATGG + Intronic
1098820016 12:75215234-75215256 ACAGAAAATCCATGTATGAGTGG + Intergenic
1098861453 12:75715482-75715504 GAAAAAGATCTATTTATAAGTGG - Intergenic
1098869381 12:75800184-75800206 GAAAAAAATCCATGTTTAAGTGG + Intergenic
1098903814 12:76140872-76140894 GAAGAAAATCTGCATCTAAGTGG - Intergenic
1098918452 12:76280814-76280836 GCAGAAAATCTGCGTCTAAGTGG - Intergenic
1098941800 12:76545968-76545990 GAAAAAAATCCGTGTATAAGTGG - Intronic
1099046636 12:77728780-77728802 GAAAAAGATCTAGGTATAAGTGG - Intergenic
1099087862 12:78268824-78268846 AAAGAAAATCTATATAAATGAGG - Intergenic
1099146399 12:79050366-79050388 GAAGAAAACCTGTGAATAAGTGG + Intronic
1099331314 12:81292380-81292402 GAAGAAAGTCTGTGTATAAGTGG - Intronic
1099999387 12:89814690-89814712 GAAGAAAATTTGCATATAAGTGG - Intergenic
1100078228 12:90814404-90814426 GAAGAAAACCAGAGTATAAGTGG - Intergenic
1100144142 12:91656667-91656689 GAAGAAAATCCACATATAATTGG - Intergenic
1100255820 12:92881892-92881914 GAAGAAAATCCACGTGTAAGTGG - Intronic
1100256192 12:92885787-92885809 GAAGAAAATTCACATATAAGTGG + Intronic
1100384721 12:94095189-94095211 GACGAAAATCCATGTACAAGTGG + Intergenic
1101076769 12:101138114-101138136 AAAAAAAATCCATGTAAAAGTGG - Intergenic
1101213621 12:102559695-102559717 AAAAAAAATCCGTGTATAAGTGG - Intergenic
1101285621 12:103309207-103309229 GAAGAAAATTCCTATATAAGTGG - Intronic
1101472810 12:105014444-105014466 GAAAATAATCCATGTATAAGTGG + Intronic
1101746085 12:107542955-107542977 GAAGAAAATCCATGTATAAGTGG + Intronic
1102189536 12:110976519-110976541 GAAGAAAATCCATGTGTAAGTGG + Intergenic
1102430715 12:112881015-112881037 GAAGAAAATCCTCATATAAGTGG + Intronic
1103022632 12:117548268-117548290 GAAGAAAATTCACATATAAGTGG - Intronic
1103163235 12:118748515-118748537 GAAGAAAATCCAAGTATAAATGG + Intergenic
1103551469 12:121740679-121740701 GAAGAAAATCTGTGTATAAGTGG + Intronic
1103806855 12:123580522-123580544 GAAAAAAATCCATATATAAGCGG - Intergenic
1104135023 12:125929447-125929469 GAAGAAAATGCATGTATAAGTGG - Intergenic
1104788052 12:131463006-131463028 GAAAAAAATCCACATATAAGTGG - Intergenic
1104982224 12:132578501-132578523 GGAGGAAATCTGTGTCTAAGTGG + Intronic
1105639646 13:22249225-22249247 AAAGCAAAACTATGGATAAGGGG - Intergenic
1105933633 13:25076805-25076827 GAAGAAAATCTACATATAAGTGG + Intergenic
1106373436 13:29160221-29160243 GAAGAAAATCCACATATAAGTGG - Intronic
1106423598 13:29604677-29604699 TAAAAAAATCCATGTATGAGTGG - Intergenic
1106492166 13:30236116-30236138 GAAGAAAAGCCATGTGTAAGGGG + Intronic
1106664666 13:31839084-31839106 GAAAAAAATCTGTGCATATGTGG + Intergenic
1106976528 13:35224105-35224127 GCAGAAAAGATACGTATAAGAGG - Intronic
1106979925 13:35267163-35267185 GAATAAAATCCATATATAAGTGG + Intronic
1107121616 13:36802464-36802486 GAAGAAAATCCACATATAAGTGG + Intergenic
1107136263 13:36947211-36947233 GAAAACAATCCATGTATAAGTGG + Intergenic
1107231989 13:38120921-38120943 GAAGAAAGTCCACATATAAGTGG - Intergenic
1107233670 13:38142486-38142508 GAACAAAATCTGGCTATAAGTGG - Intergenic
1107251447 13:38368330-38368352 GAAGAAAATCCATGTATAAATGG + Intergenic
1107367864 13:39704597-39704619 GAAGACAATCTATGTAAATGTGG + Intronic
1107442565 13:40441177-40441199 GAACAAGATCTATGTAAAAAGGG + Intergenic
1107732050 13:43358320-43358342 GAAAAAAATCCACCTATAAGTGG - Intronic
1107766409 13:43739801-43739823 GAAGAAAATTTGAGTTTAAGTGG - Intronic
1107897561 13:44981226-44981248 GAAAAAAATCCTTTTATAAGTGG - Intronic
1108020448 13:46122627-46122649 AACGAAAATATATGTTTAAGTGG + Intergenic
1108050214 13:46427503-46427525 GAAGAAAATCTGTACATAAGTGG - Intronic
1108239852 13:48452247-48452269 GAAGAAAATCTGAGTAAAAGTGG + Intronic
1108584157 13:51853571-51853593 AAAGAAAATTCATGTATAAGTGG + Intergenic
1108772670 13:53723793-53723815 GAAGAAAATCTATGTACAAGTGG + Intergenic
1108868524 13:54952192-54952214 GAAAAGAATCCATGTGTAAGTGG - Intergenic
1108954937 13:56141312-56141334 GAAGAAAATTTATGTGGAAGTGG - Intergenic
1109048303 13:57441534-57441556 TAAAAAAATCTATGTATATGTGG + Intergenic
1109258630 13:60115851-60115873 GAAAAAAACCTGTGTGTAAGGGG + Intronic
1109334353 13:60974228-60974250 AAAAAAAATCTGTGTATAAGTGG + Intergenic
1109338156 13:61019140-61019162 GAAGAAAATCTGTGTACAAGTGG + Intergenic
1109343136 13:61087453-61087475 GAGGAAAATCCATGTGTAAGAGG - Intergenic
1109479194 13:62926744-62926766 GAAGAAAATCAACCTGTAAGTGG + Intergenic
1109542734 13:63800821-63800843 GAAGAAAATCTGTACATAAGTGG - Intergenic
1109757110 13:66775473-66775495 AAAGGAAATCCATGTACAAGTGG - Intronic
1109828373 13:67753802-67753824 GAAGAAAAGCTTTACATAAGAGG + Intergenic
1109833331 13:67823317-67823339 GAAAAAAATATATTAATAAGAGG - Intergenic
1110476250 13:75917413-75917435 GAACAAAATCTATCTAGAAAAGG - Intergenic
1110935258 13:81279665-81279687 AAAAAAAGTCTATGTATAATTGG - Intergenic
1110953511 13:81523395-81523417 GAAGAAAATCCACATATAAGTGG - Intergenic
1111025608 13:82517544-82517566 AGAGAAAATCTATGTATATATGG - Intergenic
1111089917 13:83431555-83431577 GCAGAAATTGAATGTATAAGAGG - Intergenic
1111117923 13:83804990-83805012 GAAGAAAAAGAATGTATAAGTGG + Intergenic
1111270815 13:85882156-85882178 GAAGAAAATTTATGTGTAATTGG + Intergenic
1111436444 13:88215996-88216018 GAAGAAAATACACATATAAGTGG + Intergenic
1111441697 13:88290017-88290039 GAAGAAAATCTGAATGTAAGTGG + Intergenic
1111461659 13:88552269-88552291 GAAAAAAATGTATGTATAAGTGG + Intergenic
1111502927 13:89147614-89147636 AAAGAAAATCCATGTATAAGAGG - Intergenic
1111622942 13:90747472-90747494 GAAGAAAATCTGTTTCTTAGAGG - Intergenic
1112164725 13:96906093-96906115 GAAGAAAACCCACATATAAGTGG - Intergenic
1112245155 13:97726737-97726759 GAAGAAAATCCAGATATAGGTGG + Intergenic
1112430436 13:99346153-99346175 GAAGGACATGGATGTATAAGTGG - Intronic
1112538067 13:100280671-100280693 AAAGGAAAACTATGGATAAGGGG - Intronic
1113012501 13:105786089-105786111 GTATAAAATCTGTGCATAAGTGG + Intergenic
1113235906 13:108273879-108273901 GAAGAAAATCCACATACAAGGGG - Intronic
1113243348 13:108365141-108365163 GAAGAAAATCTGAGCATAAATGG - Intergenic
1113733720 13:112660837-112660859 GAAAAAAATCTGTGTGTAAGTGG + Intronic
1114133885 14:19824585-19824607 GAAGAAAATCCACATATAAGTGG - Intronic
1114332800 14:21654662-21654684 AAAAAAAATCTGCGTATAAGTGG + Intergenic
1114512336 14:23272878-23272900 GAAGATGATCTATCTAGAAGTGG - Exonic
1114933846 14:27508022-27508044 GAAGAAAATATCTGTGTAAATGG - Intergenic
1115697486 14:35915007-35915029 GAAGAAAATCCACATAGAAGTGG + Intronic
1116049537 14:39786130-39786152 GAAAAAAATCTGCATATAAGTGG + Intergenic
1116237894 14:42304491-42304513 AAAAAATATCTATGTATAAGTGG + Intergenic
1116741581 14:48761528-48761550 GAAGAAAATTCATGTATAAATGG + Intergenic
1117175443 14:53141416-53141438 GAAGAAATTCTGTTTACAAGGGG - Intronic
1117242877 14:53853036-53853058 GAAGAAAATAAGTGTATAAGTGG - Intergenic
1117282548 14:54255123-54255145 GGATAAAATTCATGTATAAGTGG + Intergenic
1117384707 14:55199772-55199794 GAAGACAATCCATGTATAAGGGG + Intergenic
1117422655 14:55562175-55562197 GAAGAAAATCCACGTGTAAGTGG + Intronic
1117433859 14:55697890-55697912 GAAAGACATCTATGTATAAAGGG + Intronic
1117639420 14:57782281-57782303 AAAAAAAATCCATGTATAAGGGG - Intronic
1117757031 14:58985798-58985820 GAAGAAAATCCATGTATAAATGG + Intergenic
1117791605 14:59347918-59347940 GAAGAAAATCTGTGTTTCACAGG + Intronic
1118105211 14:62650887-62650909 GAAAAAAATCCATATATAAGTGG - Intergenic
1118138892 14:63057747-63057769 GAAAAAAATCTGTGTACAAGTGG - Intronic
1118388182 14:65274132-65274154 AAAGAAAATTCACGTATAAGTGG + Intergenic
1118661579 14:68019508-68019530 GAAAAAAATCTACATATAATTGG - Intronic
1118832238 14:69445175-69445197 AAAGAAAATCCATGTATAAATGG - Intronic
1119120694 14:72073655-72073677 GAAGAAAATCCATGCAGATGTGG + Intronic
1119608866 14:76044790-76044812 GAAGAAAATCCTCCTATAAGTGG - Intronic
1119790130 14:77342554-77342576 TAAGAAAATCAAGGAATAAGAGG + Intronic
1119815574 14:77563756-77563778 GAAAAAAATCCACGTGTAAGTGG + Intronic
1119882338 14:78110777-78110799 GAAGAAAATCCATGTATAAGTGG + Intergenic
1120168919 14:81229486-81229508 AAAGCAAAACCATGTATAAGGGG - Intergenic
1120205685 14:81584890-81584912 TAAGAAAATCTAAGTAATAGTGG - Intergenic
1120396341 14:83971501-83971523 GAAGAAAATCCATGTATAAGTGG + Intergenic
1120440346 14:84529058-84529080 GAAGAAAATCTGTGTAAATGTGG - Intergenic
1120445976 14:84597021-84597043 GAAAAAAATCTGAGTATAAGTGG - Intergenic
1120568522 14:86089431-86089453 GAAGAAAATCAATGTATAATTGG + Intergenic
1120662370 14:87265670-87265692 GAAGAATGGCTATGTAGAAGAGG + Intergenic
1120767324 14:88341194-88341216 GAAGAAAATCTGTGTATAAGTGG - Intergenic
1120804241 14:88728672-88728694 GAAGAAAATCCACCTATAAGTGG + Intronic
1120907916 14:89636466-89636488 GAAGAAAATCCATGTAAAAGTGG - Intronic
1121150941 14:91634343-91634365 GAAAAATTTCCATGTATAAGTGG + Intronic
1121351897 14:93180299-93180321 GAAGAAAATCTGTGGATAAGTGG - Intergenic
1121393021 14:93592579-93592601 GAAAACAATCCATGTATAAGTGG + Intronic
1121460863 14:94076870-94076892 GAAGAAATTCTGTGTATAAGTGG - Intronic
1121804276 14:96801917-96801939 GAAGAAAATCTGTGTATAAGTGG + Intronic
1122001761 14:98663574-98663596 GAAGAAAATCTTTGTAACAATGG + Intergenic
1122001964 14:98665925-98665947 GAAGAAAATCGTCGGATAAGTGG + Intergenic
1122104566 14:99442481-99442503 GAAGAAAATCTATGTATAAGTGG - Intronic
1122453507 14:101831666-101831688 GAAAAAAATCCACATATAAGTGG - Intronic
1123454315 15:20405438-20405460 AAAGAAAATCTGTATATAAGTGG - Intergenic
1123576952 15:21680174-21680196 GAAGAAAATCCACATATAAGTGG - Intergenic
1123613574 15:22122642-22122664 GAAGAAAATCCACATATAAGTGG - Intergenic
1123930389 15:25167412-25167434 GAAGAAAATCCACAGATAAGTGG - Intergenic
1124095092 15:26641855-26641877 TAAAACAATCTGTGTATAAGTGG - Intronic
1124178618 15:27451741-27451763 AAAGAAAATCTATGGATTGGGGG + Intronic
1124403479 15:29372155-29372177 GAAGAAGATCCATGTGTAAGTGG - Intronic
1124406789 15:29399968-29399990 GAAGAAAATCCACATATAAGTGG + Intronic
1124420743 15:29519300-29519322 GAAAAAAATCCACATATAAGTGG - Intronic
1124465119 15:29931305-29931327 GAAGAAAATCTGCATATAAGTGG + Intronic
1124577156 15:30919864-30919886 GAAGAAAATCCACATATAAGTGG + Intronic
1124659505 15:31534920-31534942 GAAAAAAATCCACATATAAGTGG + Intronic
1124701142 15:31913299-31913321 GAAGAAAATCCATGTAAAAGTGG - Intergenic
1124811851 15:32947320-32947342 GAAGCAAATCTATGCATATATGG - Intronic
1125062873 15:35445471-35445493 AAAAAAAATCCATATATAAGTGG - Intronic
1125118836 15:36128509-36128531 GAAGAATGTCCATGTATGAGTGG - Intergenic
1125705217 15:41728692-41728714 GAAGAAAATCCATATGTGAGTGG + Intronic
1125765044 15:42129453-42129475 GAAGTAAACATATGTATATGTGG - Intergenic
1125803997 15:42476770-42476792 GAGAAAAATCTGTGTATAAGTGG + Intronic
1125873134 15:43120579-43120601 GAAAAAAATCTGCATATAAGTGG + Intronic
1126139446 15:45425213-45425235 GAAGAAAATTCACATATAAGTGG - Intergenic
1126560948 15:50043397-50043419 AAAAAAAATCTGTGTATAAGTGG - Intronic
1126718782 15:51553550-51553572 GAAGAAAATTCACGTGTAAGTGG - Intronic
1127233466 15:57021730-57021752 AAAAAAAATCTAAGTATAAATGG - Intronic
1127368665 15:58314935-58314957 GAAGAAAATCTTTGTCTAAGTGG - Intronic
1127938445 15:63667812-63667834 GAAGAAAATCCACATGTAAGTGG - Intronic
1127990925 15:64116329-64116351 GAGGAAAATTCATGTATAAATGG + Intronic
1128255519 15:66193550-66193572 GAAAAAAATCTGTGGGTAAGTGG - Intronic
1128305488 15:66595654-66595676 GAAAAGAATCCATGTATAGGTGG - Intronic
1128486688 15:68098460-68098482 GAAGAAAATCTGTGTATAAATGG + Intronic
1128974684 15:72142662-72142684 GTAGAAAATATAAGTATCAGTGG + Exonic
1129421264 15:75428809-75428831 GGAGAAAATCCATGTATAAGTGG - Intronic
1129651694 15:77495771-77495793 GATGAAAAACTAGGAATAAGGGG - Intergenic
1129782463 15:78281975-78281997 GGTGAAAATCTATTTATAAATGG + Exonic
1129809202 15:78493413-78493435 AAAAAAAATCGATGTATAAGTGG + Intronic
1130065375 15:80598637-80598659 GAAGAAAATCCACGTGTAAGTGG - Intergenic
1130085270 15:80772779-80772801 GAAAAAAATCCATGTATAAATGG - Intergenic
1130220167 15:82012774-82012796 GATGAAAATCTCTGTGCAAGTGG + Intergenic
1130359868 15:83172981-83173003 GAAGAAAATTCACGTAGAAGTGG + Intronic
1130380399 15:83367181-83367203 GAAGAAAATCTGCCTATAAGTGG + Intergenic
1130644734 15:85714354-85714376 GAAGAAATTCCACATATAAGGGG + Intronic
1130693850 15:86110563-86110585 GAAGAAAATCCATGTATGAGTGG + Intergenic
1131130084 15:89893359-89893381 GAAGAAAATCAGTTTAAAAGTGG - Intronic
1131339524 15:91584103-91584125 AAAGAAAATCCACTTATAAGTGG - Intergenic
1131409343 15:92193330-92193352 GAGGGAAATCCAGGTATAAGTGG - Intergenic
1131575216 15:93582689-93582711 GAAGAAAATCCACATATAAGTGG - Intergenic
1132223444 15:100122865-100122887 GAAAAAAACCCATGTATAAGTGG + Intronic
1132246950 15:100304794-100304816 GGTGAAAATCCATGTATAAGTGG - Intronic
1132257994 15:100394523-100394545 GAAGAAAATCCATGTAAAAGTGG - Intergenic
1132425360 15:101711420-101711442 GAAGAAAATCCACATATAGGTGG - Intronic
1202985820 15_KI270727v1_random:414419-414441 GAAGAAAATCCACATATAAGTGG - Intergenic
1134164613 16:11920118-11920140 AAAAAAAATCCATGTGTAAGTGG + Intergenic
1134331245 16:13252907-13252929 GAAGAAAATGCAAGTATAAATGG - Intergenic
1134346516 16:13396925-13396947 GAAGAAAATCCACATATATGTGG - Intergenic
1134573402 16:15311258-15311280 GAAAAAAATCCATGTATAAGTGG + Intergenic
1134728981 16:16444704-16444726 GAAAAAAATCCATGTATAAGTGG - Intergenic
1134821967 16:17254181-17254203 GAAGAAAATCTGTTTATAAATGG - Intronic
1134938454 16:18267162-18267184 GAAAAAAATCCATGTATAAGTGG + Intergenic
1135102914 16:19622567-19622589 GAAAAAAATCCGTGTCTAAGTGG + Intronic
1135682079 16:24466145-24466167 GAAGAAAATCTGCATATAAGTGG + Intergenic
1135682547 16:24470500-24470522 GAAGAAAATCCAGGTAGAAGTGG - Intergenic
1136027308 16:27477146-27477168 AAAGAAAATCTATGTATAAGTGG - Intronic
1136035305 16:27534832-27534854 AAAAAAAATCTGTGTATAAGTGG - Intronic
1136181495 16:28555496-28555518 GAAGAAAATCCACATATAAGTGG + Intronic
1137941408 16:52691175-52691197 GAAGAAAATCCGTGTACAAGTGG - Intergenic
1138026526 16:53526550-53526572 AAAAAATATCTGTGTATAAGTGG + Intergenic
1138158766 16:54732593-54732615 GAAGAAAATCCATGTGGAGGTGG + Intergenic
1138759431 16:59523353-59523375 CAAAAAAATCCATGTATAAGTGG + Intergenic
1138774296 16:59702993-59703015 GAAAAAAATGTATGTATAAGTGG - Intergenic
1138932049 16:61670994-61671016 AAAGCAAAACTATGGATAAGGGG + Intronic
1138955117 16:61962211-61962233 GAAGAAAATCTATGTACCAGTGG + Intronic
1138956189 16:61973079-61973101 GAAAAAAATCAGAGTATAAGTGG - Intronic
1139148846 16:64355668-64355690 GAAGAATATCCATTTATAACAGG + Intergenic
1139298585 16:65924174-65924196 GAAGACAGTTCATGTATAAGTGG - Intergenic
1139830091 16:69790496-69790518 GGAGAAAATCCATGTAAAAGTGG + Intronic
1140004168 16:71058787-71058809 GAAGAAAATCCACATAAAAGTGG - Intronic
1140523763 16:75604922-75604944 GAAGAAAATCTATGTGTAAGTGG - Intronic
1140553180 16:75890140-75890162 GAAGAAAATCTGTGTATACATGG - Intergenic
1141073672 16:80982063-80982085 AAAGAAAATCCAGGTATAAGTGG - Intronic
1141146053 16:81530807-81530829 GAAGATAATGTATGTAAAAGAGG - Intronic
1142576516 17:912269-912291 GAAAAAAATCTGTGTATAAATGG + Intronic
1143754958 17:9060130-9060152 GAAGAAAATCCATGTATAAATGG - Intronic
1143803612 17:9406814-9406836 GAAAAAGATCCATGTATAAGTGG + Intronic
1144096932 17:11908212-11908234 GAAAAAAATCCATGTGTAAGTGG + Intronic
1144106970 17:11995023-11995045 GATGAAAATCCTTGTATAAATGG + Intronic
1144119610 17:12138563-12138585 AAGAAAAATCCATGTATAAGTGG + Intronic
1144133897 17:12274420-12274442 GAAAAAAATCCACATATAAGTGG - Intergenic
1144187690 17:12811538-12811560 GGAAAAAGTCTGTGTATAAGTGG + Intronic
1144247206 17:13378839-13378861 GAAGAAAAAACATGTGTAAGGGG - Intergenic
1144277478 17:13687803-13687825 GAAGAAAATCTGCATATAGGCGG - Intergenic
1144279159 17:13707181-13707203 GAAGAAAATCTGCATGTAAGTGG + Intergenic
1144288475 17:13802771-13802793 AAAAAAGATCTATGTATAAGTGG + Intergenic
1144291947 17:13834925-13834947 GAAGAAAATCTGTGTATAATTGG - Intergenic
1144323963 17:14159427-14159449 GAAATAAATCCACGTATAAGTGG - Intronic
1144326679 17:14189057-14189079 GAAGAAAATGAATATATAACAGG - Intronic
1144475557 17:15585921-15585943 GAAGAAAATGAATATATAACAGG - Intronic
1144530146 17:16030312-16030334 GAAGAAAATCCATGTATAAGTGG + Exonic
1144554207 17:16267441-16267463 AAAAAATATCTTTGTATAAGTGG + Intronic
1144601488 17:16618622-16618644 GAAGTAAATCCATGTATAAGTGG - Intergenic
1145095408 17:20021218-20021240 GAAGAAAATCCACATGTAAGTGG + Intronic
1145818698 17:27814408-27814430 GAAGAAAATCCACTTATAAGTGG + Intronic
1146097885 17:29950089-29950111 GAAGAAAATCTGTGTATAAGTGG - Intronic
1146245371 17:31277208-31277230 GAAGTAAACCTCTGTATAAGTGG + Intronic
1146353311 17:32113955-32113977 GTAAAAAATGTATGTAAAAGTGG + Intergenic
1146394615 17:32454028-32454050 GTAGAAAATCTCTGTCTAAGGGG + Intronic
1146509300 17:33432117-33432139 GAAGAAAATCTACGTATTACTGG - Intronic
1147298655 17:39505707-39505729 GGATAAAATCTGTGTATAAGTGG - Intronic
1147470913 17:40660207-40660229 GATGAAAATCTATATAAAACAGG - Exonic
1147506453 17:41022294-41022316 GAAAAAAATCTGCGTGTAAGTGG + Intergenic
1147524438 17:41207417-41207439 GAAGAAAATCCACATATAAGTGG + Intronic
1147710926 17:42464046-42464068 GAGGAAAATCTGTGTGTTAGTGG + Intronic
1148066000 17:44870522-44870544 GAGAAAAATCCATGTATAATTGG - Intronic
1149070938 17:52541879-52541901 AAAAAAAATCTGTGTATAAGTGG + Intergenic
1149177366 17:53889356-53889378 AAAGCAAAACTATGGATAAGAGG + Intergenic
1149287362 17:55179559-55179581 GGAGAAAATCCATGTATATGTGG - Intergenic
1149526701 17:57361774-57361796 GAAGAAAATCCACATATAAGTGG + Intronic
1149599256 17:57882611-57882633 GAAGAAAATCTACCTATAAGTGG - Intronic
1150006067 17:61469767-61469789 GAAGAAAATCAATGTCCAAATGG - Intronic
1150448835 17:65248706-65248728 GAAAAAAATCCGTGTATCAGTGG - Intergenic
1150762528 17:67975371-67975393 GAACAAAATCTCTGTACTAGTGG - Intronic
1151039021 17:70836393-70836415 GAAGAAAATCTGTGTAGAAGTGG - Intergenic
1151145562 17:72037282-72037304 GAAGAAAATCCAAGTGTAAGTGG - Intergenic
1151230513 17:72681674-72681696 GAAGAAAATCCACATGTAAGTGG - Intronic
1151636597 17:75353350-75353372 GAAAAAAATCCGTGTATAAGCGG + Intronic
1152007627 17:77692495-77692517 GAAGGAAATCTGTGCATAAGTGG + Intergenic
1152370153 17:79882621-79882643 GAAGGAAATCTGTGTATAAGTGG - Intergenic
1153011636 18:545179-545201 GAAGAAAATCCACATATAGGTGG + Intergenic
1153137615 18:1934724-1934746 GAAGAAAATCCTTGTACAAGTGG + Intergenic
1153166303 18:2265450-2265472 GAAGAAAATCTGCGTATAAGTGG - Intergenic
1153442542 18:5136492-5136514 AAAAAAAATCCATGTACAAGTGG + Intergenic
1153499708 18:5735926-5735948 GAAGAAAATTCATGTGTAAGTGG - Intergenic
1153597124 18:6738729-6738751 GGAGTAAATCTATATTTAAGTGG + Intronic
1153807597 18:8722725-8722747 GAAGAAGATTTGAGTATAAGTGG + Intronic
1153860376 18:9197821-9197843 GAAGAAAATTCCTGTGTAAGTGG + Intronic
1154393370 18:13963840-13963862 GAACAAAATCTATATATTAATGG + Intergenic
1155106582 18:22672769-22672791 GAAGAAAATCCATGTATAACTGG - Intergenic
1155434498 18:25797414-25797436 GAAGAAATTTTATATTTAAGAGG + Intergenic
1155486017 18:26343658-26343680 GAAAAAAATCCACATATAAGTGG - Intronic
1155768306 18:29665894-29665916 AAAGAAAATCCATATATAAGCGG - Intergenic
1155935844 18:31752849-31752871 GAAGAAAATCTGCATGTAAGTGG + Intergenic
1156009924 18:32484958-32484980 GAAGAAAATCTCAGCATAAGTGG + Intergenic
1156323393 18:36049477-36049499 GAAGAAAATTCATGTATACATGG + Intronic
1156323518 18:36051069-36051091 GAAGAAAATTCATGTATACATGG + Intronic
1156514069 18:37665219-37665241 AAAGAGAATCTATTTATAAAAGG - Intergenic
1156592040 18:38501307-38501329 AAAAAAAATCTGTGCATAAGTGG - Intergenic
1156949575 18:42878503-42878525 GAAGAAAATTTGAATATAAGTGG + Intronic
1157097826 18:44702293-44702315 GAAGAAAATCTTCATATAAGTGG + Intronic
1157216733 18:45790098-45790120 GAAAAAAATCTACATATAAGTGG + Intergenic
1157462180 18:47908371-47908393 GAATAAAATCTGTGTATAAATGG - Intronic
1157542348 18:48520406-48520428 GAAGAAAATCTGTGCATAAGTGG - Intergenic
1157638792 18:49190724-49190746 GAAGAAAATGCATGTATAAGTGG - Intronic
1157672648 18:49543245-49543267 AAAAAATATTTATGTATAAGTGG - Intergenic
1157793134 18:50550780-50550802 GAAGAAAATCCACATATAAGTGG - Intergenic
1157890531 18:51412213-51412235 GAAGAAAATTTAGGTGCAAGTGG + Intergenic
1158089915 18:53698799-53698821 GAAGAAAATCTGTGAATATGTGG + Intergenic
1158091362 18:53717596-53717618 AAAGAAAATCTGTGTATAAGTGG - Intergenic
1158665133 18:59425686-59425708 GAAGGAAGTCCACGTATAAGTGG - Intergenic
1158833580 18:61306398-61306420 CAAGAAAGACTATGTATAAAAGG + Intergenic
1158835873 18:61331672-61331694 GGAGAAAATCCATGTCTAAGTGG - Intergenic
1158875155 18:61726533-61726555 GAAGAAAATCTGCATATAAGTGG + Intergenic
1159139785 18:64379691-64379713 GATGAAAATCTGCATATAAGTGG + Intergenic
1159163061 18:64669251-64669273 GAAGAAAATCTGCATATACGTGG - Intergenic
1159247494 18:65828390-65828412 GAAAAAAATCCATATATAAGTGG - Intronic
1159257139 18:65961483-65961505 GAAGAAAATCTACATGTAAATGG + Intergenic
1159344211 18:67177894-67177916 GAAGAAAATGTCTATATAATTGG - Intergenic
1159421703 18:68229707-68229729 GAAAAAAATTCATGCATAAGTGG - Intergenic
1159457776 18:68683756-68683778 AAAGTGAATCTATGGATAAGGGG - Intronic
1159753237 18:72328749-72328771 GAGGAAAACCTGGGTATAAGTGG + Intergenic
1159834621 18:73324060-73324082 GAAGAAAATCTGCGCAAAAGTGG - Intergenic
1159841012 18:73399016-73399038 GAAAAAAATGTATGTATCAATGG + Intergenic
1159979850 18:74765016-74765038 GAAGAAAATCATAGTAAAAGTGG + Intronic
1160371958 18:78380789-78380811 GAAAAAAATCTCTATAAAAGTGG - Intergenic
1160425936 18:78779258-78779280 GAAGAAAATCTCCGTGTAAATGG - Intergenic
1160476162 18:79190388-79190410 GAAGAAAATTCATGTATAAGTGG + Intronic
1161423761 19:4190748-4190770 CAAAAAAATCCATGTGTAAGTGG + Intronic
1161794526 19:6378758-6378780 CAAGAAAATCTATCACTAAGGGG + Intronic
1162429002 19:10615672-10615694 GAAGAAAAATTGTGTTTAAGGGG + Intronic
1162607769 19:11724400-11724422 GAAGAACATTCATGTATGAGTGG - Intronic
1162673100 19:12275180-12275202 GAAGAACATTTATATATAAATGG - Intronic
1162682058 19:12352513-12352535 GAAGAAAATTCATATATAAGTGG - Intronic
1162722717 19:12672121-12672143 GAAGAAAATCCACATATAAGTGG + Intronic
1163051595 19:14689019-14689041 GAAAAAAATCTACCTATAAGGGG - Intronic
1163347955 19:16756426-16756448 GAAGAAAATCCACATATAAGTGG + Intronic
1163350696 19:16774803-16774825 GAAGAAAATGGAAGGATAAGTGG - Intronic
1164623477 19:29711696-29711718 CAAGAAAATGCATGTAGAAGTGG + Intronic
1164850766 19:31482321-31482343 GCAGATAATTTATGTACAAGAGG + Intergenic
1164922391 19:32098468-32098490 GAAGAAAATCTGAATGTAAGTGG - Intergenic
1164962705 19:32448734-32448756 GAAGAAAATCTATGTATAATTGG + Intronic
1164972745 19:32546502-32546524 AAAGAAAATCTTCGTGTAAGTGG - Intergenic
1165283630 19:34818727-34818749 GAAGAAAATCCACATGTAAGTGG + Intergenic
1166621809 19:44307802-44307824 GAATACAATGTATGTATAAGTGG + Intergenic
1166649975 19:44565662-44565684 GAAGAAAATCTGCTTATAAGTGG - Intergenic
1168053467 19:53847333-53847355 GAAGAAAATCCCTGGATAAGTGG + Intergenic
1168135526 19:54348837-54348859 AAAGAAAATCTGTATACAAGTGG + Intergenic
1168451829 19:56472453-56472475 GAAAAAAATCTGCATATAAGTGG - Intronic
1168503588 19:56914241-56914263 AAAGAAAACCTGTATATAAGCGG + Intergenic
1168646804 19:58064356-58064378 GAAGAAAATCCATGTATAAATGG - Intronic
925365215 2:3306801-3306823 GAAGAAAATCCATGCGTAAGTGG + Intronic
925495454 2:4443808-4443830 GAAGAAAATCTACATATAAATGG + Intergenic
925553315 2:5100159-5100181 GAAGAAAATCTATGTATTTATGG - Intergenic
925672396 2:6325464-6325486 GAATAGAATCCATGTGTAAGAGG + Intergenic
926054533 2:9766699-9766721 GAGAAAAATCTGTGCATAAGTGG - Intergenic
926350879 2:11993295-11993317 TTAAAAAATCTCTGTATAAGTGG + Intergenic
926377081 2:12241609-12241631 GAAGAAAATCTGCGTATAAATGG + Intergenic
926452101 2:13017387-13017409 GAAAAAAATCCACGTATAAGTGG - Intergenic
926480978 2:13393696-13393718 GAAGAAAATCTGTATATAAGTGG + Intergenic
926626110 2:15091311-15091333 GAAGAAAATCCACATATCAGTGG - Intergenic
926709287 2:15864420-15864442 GAAGAAAATCTGTTTATAAGTGG - Intergenic
926897033 2:17703563-17703585 GAAGAAAATCTGTGTATAAGTGG - Intronic
927373197 2:22381679-22381701 GAGGAAAATATATGTAAATGTGG - Intergenic
927397035 2:22664512-22664534 AGAGAAAATTTGTGTATAAGTGG - Intergenic
928063801 2:28142451-28142473 GAAGAAGTTATATGTATCAGTGG + Intronic
928301734 2:30131262-30131284 AAAGAAAAAATGTGTATAAGTGG - Intergenic
928470092 2:31567331-31567353 GAAAAAATTATATGTATATGTGG - Intronic
928551593 2:32376665-32376687 GAAAAAAATTTATGTATGAGTGG + Intronic
928568133 2:32574693-32574715 GCAGAAAATCTGTATATAAGTGG + Intronic
928606971 2:32952068-32952090 GAAAAAAATTTCTGTGTAAGAGG + Intronic
928850745 2:35742562-35742584 GAAAAAAATCCATGTATAAATGG + Intergenic
929181455 2:39044620-39044642 GAAAAAAATCTGCATATAAGTGG - Intronic
929237131 2:39617271-39617293 GAAGAAAATTCATATGTAAGTGG - Intergenic
929335436 2:40738477-40738499 GAAGAAAAACTGCATATAAGTGG - Intergenic
929427515 2:41858278-41858300 GAAGAAAATTCACATATAAGTGG + Intergenic
929474073 2:42227629-42227651 GCAGAAAATCCTTATATAAGTGG - Intronic
929725365 2:44420505-44420527 GATGAAAATCCATGTATATGTGG + Intronic
929732067 2:44505716-44505738 GAAGAAAATCCATGTGTAAGTGG + Intronic
929741480 2:44605866-44605888 AAAGAAGCTCTATGTATGAGTGG - Intronic
929835968 2:45399990-45400012 GAATAAAACCTATGTATCAGAGG + Intronic
929912817 2:46106137-46106159 GAAAAAAATCCATGTATTAGTGG + Intronic
930180720 2:48353466-48353488 GAAGCAAATCTATACATAACTGG - Intronic
930321739 2:49863256-49863278 CAAGAAAATCTATGTGTAATTGG - Intergenic
930345190 2:50171177-50171199 GAAGAAACTCTATGTATAAGTGG + Intronic
930945696 2:57072266-57072288 GAAGAAAATCTGTGTGTAAGTGG - Intergenic
931014816 2:57964510-57964532 AAAAAAAATCCATGTATAAATGG + Intronic
931076284 2:58716912-58716934 GAATAAAAGAAATGTATAAGGGG + Intergenic
931225866 2:60330900-60330922 GGAAAAAATCCATGCATAAGTGG - Intergenic
931320392 2:61170257-61170279 GAAAAAAATCTGCATATAAGTGG - Intergenic
931453711 2:62390064-62390086 CAAGAAAACCCATGAATAAGTGG - Intergenic
931529281 2:63195458-63195480 AAAAAAAATCCATGTATAAGTGG - Intronic
931596560 2:63951805-63951827 AAAAAAAATCTGTGTATAAATGG + Intronic
931627447 2:64269776-64269798 GAAGAAAATCTGCATTTAAGTGG - Intergenic
931712720 2:65003056-65003078 GAAAAAAATATAGGTATATGGGG + Intronic
931831254 2:66053715-66053737 GAAGAAAATTCATGTATAAGTGG + Intergenic
931874996 2:66502839-66502861 GAAGAAAGTATAAGAATAAGGGG - Intronic
931896786 2:66740537-66740559 GAAAAATATCTGTGTGTAAGTGG + Intergenic
932051703 2:68404736-68404758 TAAGAAAGTTTATGTAAAAGAGG + Intergenic
932099105 2:68880322-68880344 GAACAACATTTATGTAGAAGGGG - Intergenic
932318853 2:70805468-70805490 GAAAAAAATCCACATATAAGTGG - Intergenic
932682027 2:73834590-73834612 GAAGTAAATCCGTGTATAAATGG + Intronic
932850168 2:75176962-75176984 GAAGGAAATCTTTGAAGAAGAGG - Intronic
932864098 2:75323610-75323632 GAAGAAAATTCATGAATAAGTGG - Intergenic
932873081 2:75423375-75423397 GAAGAAAATCTAGGTATAAGTGG + Intergenic
932895681 2:75637395-75637417 GAAGAAAATTTGCATATAAGTGG + Intergenic
932921850 2:75925012-75925034 GAAGAAAATGTACATATAAATGG + Intergenic
932995460 2:76845960-76845982 GAAAAAAATCCGTGTATAAGTGG - Intronic
933083133 2:78019271-78019293 TAAGAAAATCTCTGTGTTAGAGG - Intergenic
933134064 2:78709759-78709781 GAAGAAAATCTTTATATACTTGG + Intergenic
933300196 2:80532204-80532226 AAAGCAAAACTATGGATAAGGGG - Intronic
933448756 2:82418137-82418159 GAACAAAATTTATGTGTAAGTGG + Intergenic
933830681 2:86205502-86205524 GAAAAAAATCTGTGTGTAAGTGG + Intronic
933859552 2:86451616-86451638 GAAGGAAATCTGTTTATAATGGG + Intronic
934028887 2:88023781-88023803 GAAGAAAATCTGTGTATAAGTGG + Intergenic
934158414 2:89225125-89225147 GAAGAAATTTGCTGTATAAGGGG + Intergenic
934208857 2:89957302-89957324 GAAGAAATTTGCTGTATAAGGGG - Intergenic
934592990 2:95574833-95574855 GGTGAAAATCTATGTACATGTGG - Intergenic
934719502 2:96563707-96563729 GAAAAAAATCAAAATATAAGCGG + Intergenic
934995971 2:98960753-98960775 AAAAAAAATCCATGTATAAGTGG - Intergenic
935037333 2:99391327-99391349 GAAGAAAATCTGAGTATAAGTGG + Intronic
935406344 2:102714032-102714054 GAAGAAAATCCCCGTTTAAGTGG - Intergenic
935507381 2:103922092-103922114 AAAAAAAATATATATATAAGTGG + Intergenic
935556030 2:104510456-104510478 GAAGAAAATCCATCTATAAGTGG + Intergenic
935714246 2:105926061-105926083 AAAGAAAATCCATATATAAGTGG + Intergenic
935821666 2:106899004-106899026 GAAAAAAATTCATGTATACGTGG + Intergenic
936031868 2:109079107-109079129 GAAGAAAATCCCCATATAAGTGG - Intergenic
936115515 2:109699702-109699724 GAAGAAAATCCTTGTATATGTGG + Intergenic
936444053 2:112582363-112582385 GAAGAAAATCTGAGTATAAGTGG + Intergenic
936454815 2:112664843-112664865 AAAGTAAGTCTGTGTATAAGTGG + Intergenic
936496562 2:113027325-113027347 GAAAAAAATCAGTGTTTAAGTGG + Intronic
936666710 2:114605291-114605313 GAAGAAAATCCACGTATAGGTGG - Intronic
937020155 2:118643096-118643118 GAAGAAAATTCACATATAAGTGG + Intergenic
937141044 2:119600708-119600730 GAAAAAAATCTGAATATAAGTGG - Intronic
937162047 2:119773323-119773345 AAAAAAAATCCACGTATAAGTGG - Intronic
937286266 2:120754287-120754309 GAAGAGAAACTATGTTTCAGCGG + Intronic
937474171 2:122200119-122200141 GAAAAAAATCTGTGCATAAGTGG + Intergenic
937481431 2:122264163-122264185 GAAAAAAATCCACATATAAGTGG + Intergenic
937498163 2:122447845-122447867 GAAGAAAATCCAGGTATAAGTGG - Intergenic
937528384 2:122798931-122798953 GAAGAAAATCTTTGTGTAAATGG - Intergenic
937549629 2:123071372-123071394 GAAGGAAATCCACATATAAGTGG + Intergenic
937766843 2:125671288-125671310 GAAGAAAATCCACATATAAGTGG - Intergenic
937777609 2:125798380-125798402 GAAGAAAATCTCCATATAGGTGG + Intergenic
938588914 2:132718704-132718726 CAAGGAAATGTATGCATAAGGGG + Intronic
938601159 2:132840904-132840926 AAAAAAAATCTGTGTATAATTGG + Intronic
938656789 2:133442740-133442762 GAAGAAAAACCATGTTTAAAGGG + Intronic
938824331 2:134990276-134990298 GAAGAAAATCCACATATAGGTGG - Intronic
939018684 2:136932757-136932779 GAAGAAAATCCACATATAAGCGG + Intronic
939197738 2:138992943-138992965 GAAGAAAATTCACCTATAAGTGG + Intergenic
939200528 2:139028715-139028737 GAAGAAAATCTGCATATAAGTGG - Intergenic
939279642 2:140045783-140045805 GAAGGAAATCCAAGTATAAGTGG + Intergenic
939465527 2:142550217-142550239 GAAGTAAATCCATGTATATAAGG + Intergenic
939574777 2:143882987-143883009 GAAAAAAATCCGTGTATAAATGG + Intergenic
939668305 2:144977960-144977982 GGAGAAAAGCTATCTACAAGTGG - Intergenic
939713559 2:145554933-145554955 GAAGAAAATCCACATATAAGTGG - Intergenic
939773946 2:146361032-146361054 GAAGAAAATCCACGTATAAGTGG + Intergenic
939887015 2:147692064-147692086 GAAGAAAATCTTCATGTAAGAGG - Intergenic
940074765 2:149729108-149729130 GAATAAAGTCTATGTGTAAAGGG + Intergenic
940102003 2:150051188-150051210 GAATAAAATCTGTGTATAAAAGG - Intergenic
940142782 2:150512624-150512646 GAAAAAAATCCACATATAAGTGG + Intronic
940315764 2:152326028-152326050 GAAGAAAATATGTGTAGAAATGG - Intergenic
940348820 2:152658086-152658108 TAAGAACATCTATGTGTAACAGG + Intronic
940430253 2:153581650-153581672 GAGTAAAACTTATGTATAAGGGG + Intergenic
940538552 2:154979926-154979948 TAAAAAAATCCATGTACAAGTGG + Intergenic
940875983 2:158897587-158897609 GAGGAAAATCTATGTATATATGG - Intergenic
940930941 2:159430185-159430207 GAGGAAAATCTGAATATAAGTGG - Intronic
941102098 2:161308013-161308035 GAAGAAAATTTTTTTAAAAGAGG - Intergenic
941109272 2:161400455-161400477 GAGAAAAATCCATGTATAAGTGG - Intronic
941128803 2:161620835-161620857 GAAGAAAATCTACATATAAGTGG - Intronic
941296975 2:163751104-163751126 GAACATATTCTATGTATAAATGG + Intergenic
941819840 2:169833168-169833190 TAAAAAAATCCTTGTATAAGTGG + Intronic
941872325 2:170398899-170398921 GAAAAATATCTATGTATAGGAGG + Intronic
941875627 2:170429996-170430018 AAAAAAAACCTGTGTATAAGTGG - Intronic
941981858 2:171467160-171467182 GAAAAAAATCTGTGTATAAGTGG - Intronic
942009333 2:171743346-171743368 GAAGAAAATATGAGTATAAGTGG + Intronic
942061001 2:172228677-172228699 GAAGCAAATCTTTGTGAAAGAGG + Intergenic
942083251 2:172421570-172421592 TAAAAAAATCCATGTGTAAGTGG - Intergenic
942266630 2:174233996-174234018 GAAAATAATCTGTGTATAAGTGG - Intronic
942350787 2:175050754-175050776 GAAGAAAATCTGTTTATAAATGG + Intergenic
942361344 2:175175212-175175234 GAAAAAAATCTGTGTATAAGTGG + Intergenic
942382025 2:175401477-175401499 GAAGTAAATCTATATAAAATGGG + Intergenic
942478978 2:176361919-176361941 GAAGAAAATCCATATGTAAGTGG + Intergenic
942783647 2:179675356-179675378 GAAGAAAATCTGCATGTAAGTGG + Intronic
942909520 2:181226327-181226349 AAAAAAAATCCATGTATAAATGG - Intergenic
942952988 2:181742709-181742731 GAAAAAAATGTATGTTTGAGTGG - Intergenic
943067876 2:183107609-183107631 GAAGAAAATCTGCATGTAAGTGG + Intergenic
943153284 2:184141065-184141087 GATGAGAATCTATATATAAGTGG + Intergenic
943332243 2:186573325-186573347 GAAGAGAATATATGATTAAGCGG + Intergenic
943439838 2:187915274-187915296 GAAGAACATCCACATATAAGTGG + Intergenic
943579817 2:189672157-189672179 GCAGAAAATCCACATATAAGTGG - Intergenic
943597455 2:189875450-189875472 GAAAAACATCCATGTATAAGTGG + Intronic
943901607 2:193445617-193445639 AAAGAAAATCCATGTATAAATGG + Intergenic
943950316 2:194126132-194126154 GAAGAAAATTCAGATATAAGTGG - Intergenic
943975929 2:194477028-194477050 GAAGTAAATACATGTATAAGCGG - Intergenic
944095159 2:195958098-195958120 GAAAAAAATCCGTGTAAAAGTGG - Intronic
944658893 2:201903814-201903836 GAAGAAAATCCACTTATAAGTGG + Intergenic
945128512 2:206540292-206540314 GAAAAAAGTCTACATATAAGTGG - Intronic
945138823 2:206661479-206661501 GAAGAAAATTCACATATAAGTGG - Intronic
945275272 2:207981955-207981977 GAAGAAAATCCAGGTATAAGTGG - Intronic
945625242 2:212196484-212196506 GAAAAAAATTCATGTCTAAGTGG + Intronic
945643922 2:212466248-212466270 GAGGAGAATCCACGTATAAGTGG - Intronic
945705070 2:213220424-213220446 AAAAAAAATGTGTGTATAAGTGG + Intergenic
945735832 2:213599378-213599400 GAAGAAGGTCCAAGTATAAGTGG - Intronic
945766793 2:213990736-213990758 GAGGAAAATCTATGTATAAGTGG + Intronic
945783944 2:214210269-214210291 TGAAAAAATCCATGTATAAGTGG - Intronic
945820244 2:214655299-214655321 GAAGAAAATCCATTTATAAGTGG - Intergenic
945830831 2:214783205-214783227 AAAAAAAATCTGTATATAAGTGG + Intronic
946384180 2:219371840-219371862 GAAGAAAATCCACATATAAATGG - Intergenic
946443890 2:219721570-219721592 GAAAAAAATCCAGGTATATGTGG + Intergenic
946693386 2:222327378-222327400 GAAGAAAATCCATGTATAAATGG - Intergenic
946699912 2:222402051-222402073 GAAGAAAATCCACATATAAGTGG - Intergenic
946911028 2:224460906-224460928 AAAAAAAATCTACGTATAAGTGG + Intergenic
946970506 2:225085869-225085891 GAAGTAAATCTGTGTGTAAGTGG - Intergenic
947069029 2:226265336-226265358 GAAGAAAGTCCATAGATAAGGGG - Intergenic
947309725 2:228788045-228788067 GAAGAAAATCCACATATAAGTGG - Intergenic
947476920 2:230458443-230458465 GAAGAAAATCTGCATACAAGTGG + Intronic
948069964 2:235112859-235112881 GAAGAAAATCCATGTATAAGTGG - Intergenic
948926244 2:241100324-241100346 GAAGAAAATCCACATATAAGTGG - Intronic
948931543 2:241135442-241135464 GAAAAGAATCTGTGTATAAGTGG + Intronic
1169076925 20:2766604-2766626 CAAGATAATCTAAGGATAAGTGG - Intergenic
1169184202 20:3599574-3599596 GAAAAAAGTCTACGTGTAAGTGG - Intronic
1169322753 20:4647686-4647708 GAAAAAAATCTGCGTATAAGTGG - Intergenic
1169615722 20:7442814-7442836 GAAGAAAATCCTCATATAAGTGG - Intergenic
1169657703 20:7943216-7943238 AAAGAAAATCTACATATAAGTGG - Intergenic
1169740767 20:8891660-8891682 GAAGAAAATGTATTTATTAAGGG + Intronic
1169784233 20:9341672-9341694 AAAAAAAATCCATGTATAAGTGG + Intronic
1169784487 20:9344393-9344415 GAAGAAAATAAATGAATAAATGG - Intronic
1170027250 20:11902993-11903015 GAAAAAAATCTAGATATAAGTGG + Intronic
1170419320 20:16176877-16176899 GAAGAAAATCTATGAATATGTGG - Intergenic
1170433014 20:16294536-16294558 GATGAAAGTCTGTGGATAAGTGG - Intronic
1170483938 20:16795806-16795828 GAAGGAAATCTACATACAAGTGG + Intergenic
1170533750 20:17319970-17319992 TAGGAAAATTTATTTATAAGGGG + Intronic
1170602740 20:17854118-17854140 GAAAAAAATCCATGTAGAAGAGG + Intergenic
1170682266 20:18537018-18537040 GAAGAAAATCCACATATAAGTGG + Intronic
1170903403 20:20488157-20488179 GAAAAAAATCCATGTGTAGGTGG + Intronic
1170951372 20:20939151-20939173 GAAGAAAATCTGCATATAAGTGG - Intergenic
1171040328 20:21756887-21756909 GTAGAAAATCCATGTATAAGTGG + Intergenic
1171219694 20:23384053-23384075 GAAAAAAATCCGTATATAAGTGG - Intronic
1172123157 20:32610323-32610345 AAAGAAAATCTAAGTAGAAGAGG + Intergenic
1172724699 20:37029399-37029421 GAAAAAAATCTGTATATAAGTGG + Intronic
1172760771 20:37319889-37319911 GAAAAAAAGCTGCGTATAAGTGG - Intergenic
1172921014 20:38482310-38482332 GAAGAAAATCCATATGTAAGTGG + Intronic
1173216025 20:41084802-41084824 GAAGCAGACCTATGTATAGGTGG + Intronic
1173387462 20:42602175-42602197 GAAGAAAATGAATGTGTTAGTGG - Intronic
1174059524 20:47822714-47822736 GAAGAAAATCTGCGTATATGTGG - Intergenic
1174520524 20:51126695-51126717 GAAAAATATCCTTGTATAAGTGG - Intergenic
1174733848 20:52945142-52945164 GAAAAACATCTGTGTATAAATGG + Intergenic
1174839640 20:53889567-53889589 AAAAAAAATCTACGTATAAGTGG + Intergenic
1174859179 20:54074230-54074252 GGAAAAAATCCATGTCTAAGTGG - Intergenic
1175031855 20:55962639-55962661 TACTTAAATCTATGTATAAGTGG - Intergenic
1175096796 20:56547643-56547665 GAAGAAAATCTGAGCATAGGTGG + Intergenic
1175371189 20:58494195-58494217 GAAGAAAATCTGGGGATAAGTGG + Intronic
1176917316 21:14642150-14642172 AAAGAAAATCTGTGTATAAGTGG + Intronic
1176947327 21:14998592-14998614 GAAGAAAATTTGCTTATAAGTGG - Intronic
1177219876 21:18178778-18178800 GAAGAAAATCTGTATATAAATGG + Intronic
1177297362 21:19193662-19193684 GAAGAAAATCTGTGTAAAATCGG - Intergenic
1177303365 21:19280391-19280413 GAAGAAAATTCATGGATAACTGG + Intergenic
1177345537 21:19863748-19863770 TAAGAAAATCCATGTATAAGTGG - Intergenic
1177362661 21:20093584-20093606 AAAAAAAATTCATGTATAAGTGG + Intergenic
1177362937 21:20097673-20097695 GAAGAGAATTTGTGTATAAGTGG + Intergenic
1177366714 21:20149160-20149182 GGAGAAAATCTGTGTATAAGTGG + Intergenic
1177544755 21:22542472-22542494 GAAGAAAATCTGCATATAAGTGG - Intergenic
1177635678 21:23783972-23783994 AAAAAAAATCTGTGTAGAAGGGG - Intergenic
1177676349 21:24305811-24305833 GAAGAAAAACTGTGTTAAAGAGG - Intergenic
1177742604 21:25171743-25171765 GAAGAAAATCTTTCTAACAGTGG + Intergenic
1177750470 21:25277290-25277312 GAAAAAAATCTACATATAAGTGG + Intergenic
1177874818 21:26619061-26619083 TTAGAAAATCTATGAAAAAGTGG + Intergenic
1177898881 21:26888962-26888984 GAAGAAAATATATGAGTAAAAGG + Intergenic
1177909978 21:27018980-27019002 GAAGAAAATCTCTGTACCAGTGG + Intergenic
1177931932 21:27296048-27296070 GGAGAAAATGTATGCAAAAGAGG + Intergenic
1177934836 21:27331997-27332019 TGAGAAAATCTAGGTATAAAGGG + Intergenic
1177946569 21:27478201-27478223 AAAAAAAATCCATGTATAAGTGG - Intergenic
1177969757 21:27775600-27775622 GAAGAAAATCCACATACAAGTGG - Intergenic
1177972381 21:27806654-27806676 GAAAAAAAAGTATGTAAAAGTGG - Intergenic
1178208626 21:30501033-30501055 GAACAAAATCTCAGTATGAGTGG - Intergenic
1178371223 21:32029072-32029094 GAAGGAAATCCACGTAGAAGTGG - Intronic
1178449839 21:32687740-32687762 GAAAAAAATCCATATATAAGTGG - Intronic
1178563187 21:33658302-33658324 GAAGAAAATCTGAATATGAGTGG + Intronic
1178932748 21:36833979-36834001 GAAAAGAATCCACGTATAAGTGG - Intronic
1179519992 21:41936635-41936657 GGAAAAAATCTATGTATTAGTGG - Intronic
1179772477 21:43632537-43632559 GAAGAAAATTCTTGTGTAAGTGG - Intronic
1179893186 21:44347973-44347995 GAAGAAAATCTGCATAGAAGTGG + Intergenic
1180989585 22:19926971-19926993 AAAAAAAATCCATGTATGAGTGG - Intronic
1181020196 22:20096354-20096376 GAAGAAAATTTTTGTATAAGTGG + Intronic
1181820795 22:25473959-25473981 GAAGAAAATCCAGGAATAAGTGG + Intergenic
1182138964 22:27935418-27935440 AAAAAAAATCCATGTATAAGTGG - Intergenic
1182404236 22:30110780-30110802 GAAAATAATCCATATATAAGTGG - Intronic
1184462133 22:44645064-44645086 AAAGAAAATGCAAGTATAAGTGG + Intergenic
1185183267 22:49376350-49376372 GAAGAAAATCCAAGTATTAGTGG - Intergenic
949152709 3:789813-789835 GAAAATAATGTATGTATAAGTGG + Intergenic
949157126 3:842429-842451 GAAGAAAATCCACCAATAAGTGG - Intergenic
949211448 3:1507824-1507846 GAAGATAATATAAGTATTAGAGG - Intergenic
949248709 3:1957185-1957207 AAAGAAAATCCATGTATAAGTGG - Intergenic
949273130 3:2244213-2244235 AAAAAAAATCTATGTAAATGTGG + Intronic
949335614 3:2971233-2971255 GAAGAAAATGTGTGTATTAGTGG + Intronic
949378565 3:3418195-3418217 TAAGAAAATATATTTATAAAGGG - Intergenic
949557116 3:5164156-5164178 GGAAAAAATCCATGTGTAAGTGG + Intronic
949647707 3:6116613-6116635 GTAGAAAATCTTTGTATAAGTGG + Intergenic
949822788 3:8134292-8134314 AAAGAAAATCTGCTTATAAGTGG - Intergenic
949994754 3:9607869-9607891 GAAGAAAATCCACATATAAGTGG - Intergenic
950156936 3:10728535-10728557 GAAGAAAATCTGGGTATAAGGGG - Intergenic
950818642 3:15734044-15734066 GAAAAAAATCCATATATAAGTGG - Intronic
950820857 3:15756975-15756997 GAAGAAAATCTACATATAAGTGG - Intronic
951131345 3:19049088-19049110 GAAGAAAATCCATGTAGAAGTGG - Intergenic
951141230 3:19163689-19163711 GAAGAAAATCCTTGTATAAGTGG - Intronic
951170516 3:19536654-19536676 GAAGAAAATCTGCATATGAGTGG + Intergenic
951568054 3:24031951-24031973 GAAGAAAATCTACATATAAGTGG + Intergenic
951826005 3:26869488-26869510 GAAGAAAATTTACTTAAAAGAGG - Intergenic
951834092 3:26961843-26961865 GAAGAAAATCCATAGATAAGAGG - Intergenic
951854653 3:27181507-27181529 GAAGAAAATTCATGTATAAGTGG + Intronic
951942741 3:28098753-28098775 GAAGAAAATCCATGTGTAAGTGG - Intergenic
952098720 3:29985938-29985960 GAAGAAATTCTGTGAATTAGAGG - Intronic
952388173 3:32858131-32858153 GAAGAAAATCTATGTATAAGTGG + Intronic
952464293 3:33565003-33565025 GAAGAAAATCCACGTGTAAGTGG - Intronic
952600882 3:35081217-35081239 GAAAAAAATGTACATATAAGTGG + Intergenic
952683732 3:36124991-36125013 AAGGAAAATCTATGTATCATTGG + Intergenic
952835049 3:37595322-37595344 GAAGAAAATCTAGGAAGAAAAGG + Intronic
953866303 3:46586068-46586090 AAAGAAAATTCGTGTATAAGTGG + Intronic
953924107 3:46972501-46972523 AAAGAAAATATATATACAAGTGG + Intronic
953938252 3:47066016-47066038 GAAGAAAATCCACATATAAGTGG - Intronic
953947037 3:47158346-47158368 GAAAAAAATCTGTGTATAAGTGG - Intronic
953965558 3:47302649-47302671 GAAGAAAATTTGTGTACAAGTGG + Intronic
954453510 3:50584539-50584561 GAAGAAAATGTATGTAACAATGG + Exonic
954555653 3:51515894-51515916 GAAAAACATTTTTGTATAAGTGG + Intergenic
954761313 3:52876500-52876522 GGAGAAAATCCGTGTATAAGTGG - Intronic
954946676 3:54431509-54431531 GAAGAAAATCCACATATAAGTGG + Intronic
955261883 3:57399662-57399684 GAGGAAAATCTACATATAAGTGG - Intronic
955552311 3:60097494-60097516 AAAGAAAATCCATGTGTAAGTGG - Intronic
955660461 3:61293514-61293536 GAAGAAAATTCATGTATAAGTGG + Intergenic
955689817 3:61579908-61579930 AGAAAAAATCCATGTATAAGTGG - Intronic
955754112 3:62210613-62210635 GAAGAAAACTCGTGTATAAGTGG - Intronic
955897313 3:63714224-63714246 GAAATAAATATACGTATAAGTGG - Intergenic
955902092 3:63767421-63767443 GAAAAAAATCTGTATATAAATGG + Intergenic
956028775 3:65013056-65013078 GAAGTAAGACTATGGATAAGGGG - Intergenic
956150895 3:66241146-66241168 GAAAAAAAGCCATGTGTAAGTGG + Intronic
956794526 3:72705687-72705709 AAAGAAAATCCATGTGTAAGTGG - Intergenic
957002891 3:74907448-74907470 GAAGAAAATCCATGCCTAAATGG - Intergenic
957163423 3:76639979-76640001 AAAGAAAATCTATTTTTACGGGG + Intronic
957347849 3:78984870-78984892 GAAGGAAATTCACGTATAAGTGG - Intronic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
957455952 3:80445498-80445520 ATAGAAAATCTATGCAGAAGAGG + Intergenic
957681720 3:83444438-83444460 GAAGAAAACTTATGTATAATGGG + Intergenic
958071728 3:88622818-88622840 AAAGAAAATCCAAGTATAAGTGG - Intergenic
958269433 3:91480960-91480982 GAAAAAAATCCACATATAAGTGG + Intergenic
958574696 3:95933746-95933768 GAAAAAAATCTGTATATAAGTGG + Intergenic
959153832 3:102641823-102641845 GAAAAAATTCCGTGTATAAGTGG - Intergenic
959444557 3:106422509-106422531 AAAAAAAATCAGTGTATAAGTGG - Intergenic
959545892 3:107596077-107596099 GAAAAGAATCTGTGTGTAAGTGG + Intronic
959561741 3:107790172-107790194 AAAGAAAATAAATGGATAAGTGG - Intronic
959596999 3:108139660-108139682 AAAGAAAACCCATGTATAAGTGG - Intergenic
959732040 3:109615585-109615607 GAATAAAATTCATGTATAAGTGG - Intergenic
959795301 3:110420508-110420530 GAAGAAAACTCATGTATAAGTGG - Intergenic
959830918 3:110861562-110861584 AGAGAAAGTCTGTGTATAAGTGG - Intergenic
959837275 3:110934631-110934653 GAAAAAATTCCATGTGTAAGTGG + Intergenic
959853155 3:111114788-111114810 AAAAAAAATCCATGTATAAAGGG - Intronic
960576328 3:119233406-119233428 GAAAACAATCTGAGTATAAGTGG - Intronic
961101633 3:124203872-124203894 TGAAAAAATCCATGTATAAGTGG - Intronic
961685082 3:128624506-128624528 GAAAAAAATCTGCATATAAGTGG + Intronic
961922469 3:130442265-130442287 AAAGAAAATCTATGTGAAATAGG + Intronic
962162641 3:133015087-133015109 GAAGATAATCCATGCATAAATGG - Intergenic
962708874 3:138069083-138069105 GAAGAAAATCCACGTATAAGTGG - Intronic
963146339 3:141999084-141999106 GAAGAAAATCCATGTATAAGTGG - Intronic
963405872 3:144863170-144863192 GGAGAAAATCCATGTATGATTGG - Intergenic
963469301 3:145718315-145718337 GAAGAAAATCTGTATATAAGTGG + Intergenic
963490800 3:145998060-145998082 GAGGAAAATCTGAGTATAAGTGG - Intergenic
963743635 3:149104104-149104126 GAAGAAAATCTGCATATAAGTGG - Intergenic
963775277 3:149432929-149432951 GAAGAAAATCCACACATAAGTGG + Intergenic
963839768 3:150093394-150093416 GAAAAAAATCCACATATAAGTGG - Intergenic
963841547 3:150112433-150112455 GGAAAAAATTTGTGTATAAGTGG - Intergenic
964025806 3:152072600-152072622 AAAAGAAATCAATGTATAAGCGG + Intergenic
964113330 3:153109976-153109998 AAAGAAAATCCACATATAAGTGG - Intergenic
964311360 3:155396679-155396701 GAAGAAAATCTGCATATAAATGG + Intronic
964372527 3:156015912-156015934 GAAGAAAATCCACGTGAAAGTGG + Intergenic
964446759 3:156767451-156767473 AAAGCAAAACTATGGATAAGTGG + Intergenic
964578486 3:158202455-158202477 GAAGAAAATCCACATGTAAGTGG + Intronic
964817034 3:160728356-160728378 GAAGAAAAGCCATGTATAAATGG - Intergenic
964836570 3:160945706-160945728 GAAGAAAATCTGTGTGTACGTGG - Intronic
964947160 3:162240146-162240168 GAAGGAAATCAAGTTATAAGAGG + Intergenic
964973256 3:162587196-162587218 GAACAAAAGCTGTGTAAAAGTGG - Intergenic
965069538 3:163900872-163900894 CATGAAAATGTATGTAGAAGGGG + Intergenic
965108234 3:164386784-164386806 GAAGAAAAACTATTTAAATGTGG - Intergenic
965187116 3:165479148-165479170 AAAAATAATCTGTGTATAAGTGG + Intergenic
965210274 3:165777709-165777731 GAAGAAAATCCACATGTAAGTGG - Intronic
965319816 3:167239379-167239401 GAAGAAAATCCATGTATAAGTGG - Intergenic
965327430 3:167324521-167324543 GAAGAAAATTTCTGTTTAATGGG - Intronic
966370950 3:179250206-179250228 GAAGAAAATCCATTTATAAGTGG + Intronic
966545375 3:181140715-181140737 GAAGAAACTATATGTTTAGGAGG - Intergenic
966563149 3:181345895-181345917 GAAGAAAATCTGTATTTAAGTGG - Intergenic
966650508 3:182295495-182295517 GAAGAAAATATATGTCTCCGAGG + Intergenic
966655149 3:182348087-182348109 TAAAAAAATCTAGGAATAAGAGG + Intergenic
966760520 3:183413943-183413965 GAAGAAAATCCACGTATAAGTGG + Intronic
966765059 3:183453733-183453755 GAAGAAAAGCCACGTGTAAGTGG + Intergenic
966841433 3:184091712-184091734 GAAGAAAATCTGAAGATAAGTGG - Intergenic
967232548 3:187354042-187354064 GAAGAAAACCCATGTATAAGTGG + Intergenic
967571548 3:191034924-191034946 GAAGCAAAGCCATGAATAAGGGG + Intergenic
968030042 3:195475768-195475790 GATGAAAAACTAAGTATATGAGG - Intergenic
968840876 4:3004822-3004844 GAAGAAAATACATACATAAGTGG + Intronic
969665524 4:8555070-8555092 GGTGAAAATCCATGTATAAGTGG - Intergenic
970000437 4:11359952-11359974 GAAAAAGATCTATGTATCAGTGG - Intergenic
970024312 4:11605896-11605918 GAAAAAAATCTGTGCAAAAGGGG + Intergenic
970326841 4:14934581-14934603 GAAGCAAATTCATATATAAGTGG + Intergenic
970687267 4:18582849-18582871 GAAGAAAGCCTATGAATAATGGG + Intergenic
971025228 4:22582778-22582800 GAAGAAAATTCACGTATAAGTGG - Intergenic
971032642 4:22657705-22657727 GAAGGAAATCTGTGTACAAGTGG - Intergenic
971105599 4:23521060-23521082 AAAAAGAATCCATGTATAAGTGG + Intergenic
971174016 4:24263526-24263548 GAAAAAGACCTCTGTATAAGTGG - Intergenic
971407203 4:26333072-26333094 GAAAAAAATCCACATATAAGTGG - Intronic
971428102 4:26535663-26535685 GAAGAGAATTTGAGTATAAGTGG - Intergenic
971491084 4:27212671-27212693 GAAGAAAACGCATGTATAAGTGG - Intergenic
971551292 4:27959881-27959903 GAATAAAATCTATGCATAGGTGG + Intergenic
971606980 4:28670440-28670462 GAAGAATTTCTATGAATATGAGG - Intergenic
971621711 4:28862890-28862912 GAAAAACATCTGTGTATAAATGG + Intergenic
971745850 4:30579289-30579311 GAATAAAATATAAGTATAATGGG + Intergenic
971885314 4:32438437-32438459 GAAAAAAATATATGTATAAGGGG + Intergenic
971928908 4:33052634-33052656 GAAGAAAACTTATGTATAAATGG - Intergenic
971983823 4:33793343-33793365 GACGAAAATTCACGTATAAGTGG - Intergenic
972029742 4:34439524-34439546 GAAAAAAATCCATGTGTTAGTGG + Intergenic
972086119 4:35218814-35218836 GAAGAAAATCCCTATCTAAGTGG - Intergenic
972189425 4:36572405-36572427 GAAGAAAATTGATGAATTAGAGG + Intergenic
972319431 4:37959503-37959525 GAAGAAAATCTGAGAACAAGTGG + Intronic
972392896 4:38629844-38629866 GAAGAAAATCCATGCGTAAGTGG + Intergenic
972478145 4:39472350-39472372 GAAGAAAATCCTTGTATAAGTGG + Intronic
972646156 4:40969327-40969349 GAAGAAAATCTAATGAAAAGTGG + Intronic
972729450 4:41779289-41779311 GAAGAAAATCCACATAAAAGTGG - Intergenic
972861845 4:43178630-43178652 AAAAAAAATCTGTGTGTAAGTGG + Intergenic
972897465 4:43641201-43641223 GAAAAAAAATCATGTATAAGTGG - Intergenic
972925873 4:44006453-44006475 GAAGAAAATCCATGTATAAGTGG - Intergenic
972978401 4:44665018-44665040 GAATGAAATCTCTGTGTAAGAGG + Intronic
973133880 4:46682073-46682095 GAAAAAAATCTGGGTGTAAGTGG - Intergenic
973161194 4:47018862-47018884 GAAGAAAATCCGCGTATAAGTGG + Intronic
973243845 4:47988873-47988895 GAAAAAAATCCACATATAAGCGG + Intronic
973285001 4:48404956-48404978 TAACAAAGTTTATGTATAAGTGG - Intronic
973630399 4:52815014-52815036 AAAAAAAACCTATGTATATGTGG + Intergenic
973865840 4:55112188-55112210 GAAGAAAATCTGCTTATAAGTGG - Intronic
974290546 4:59924206-59924228 AAAGAAAATCAATATATAAAAGG + Intergenic
974337990 4:60576401-60576423 GAAAAATATCTGTGTATAAGTGG - Intergenic
974379552 4:61120961-61120983 GGAGACAGTCTATGTAAAAGGGG - Intergenic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974460718 4:62184337-62184359 GAAAAATATCCATGTATAAGTGG + Intergenic
974536021 4:63176900-63176922 AAAAAAAATCCATATATAAGTGG - Intergenic
974623188 4:64386438-64386460 GAAGAAAATCCATTTATAGGTGG + Intronic
974687992 4:65256206-65256228 AAAGAAAATCTCTGAGTAAGTGG + Intergenic
974853825 4:67435307-67435329 GAAGAAAATCCATGTGTAAGTGG - Intergenic
974939513 4:68448818-68448840 GAAGCACATCTATGTTTGAGTGG + Intronic
975273728 4:72469651-72469673 GCAGAAGATCCATGTATAAATGG - Intronic
975286128 4:72622625-72622647 GAAGAAAATCCACATGTAAGTGG + Intergenic
975428461 4:74258457-74258479 AAAAAAAATCTGTGTATAAATGG - Intronic
975443912 4:74440882-74440904 GAAAAAAGTCTCTGTTTAAGTGG - Intergenic
975467379 4:74723800-74723822 GAAGAAAATGCATGTATTTGGGG - Intergenic
975527084 4:75362680-75362702 GAAGAAAATCCACATATAAGGGG + Intergenic
975567831 4:75778474-75778496 GAAGAAAACATATATATAAGTGG + Intronic
975601984 4:76110735-76110757 AAAAAAAATCCATGTATAAGTGG - Intronic
975663062 4:76706630-76706652 GAAAAAAATCTGCGTATAAGAGG + Intronic
975775716 4:77784823-77784845 GATGAAAATGTACGTATCAGAGG - Intronic
975908243 4:79241089-79241111 GAAGAAAATCTATGTACAAGTGG - Intronic
976429140 4:84942998-84943020 GAAGAAAATCCACATATAATTGG - Intronic
976431782 4:84970558-84970580 GCAGAAAATCTACATAGAAGTGG - Intergenic
976459744 4:85296033-85296055 GAAAAAAATCCATGTATAAGTGG - Intergenic
976691660 4:87874565-87874587 GAAGGAAATCCATGTGTAAGTGG + Intergenic
976737573 4:88326173-88326195 GAAGAAAATCCATGTATAATTGG - Intergenic
977068025 4:92344063-92344085 TAAGAAAATCTGCATATAAGTGG + Intronic
977412728 4:96688917-96688939 TTAAAAAATATATGTATAAGAGG - Intergenic
977512825 4:97983077-97983099 GAAGAAAATTTGTGTATAAGTGG - Intronic
977550357 4:98435592-98435614 GAAGAAAATCCAGGTATAATTGG + Intronic
977552722 4:98459008-98459030 AAAGAAAATCCATGTACACGTGG + Intergenic
977788518 4:101069643-101069665 GAAGAAAATCTGCATATAAGTGG - Intronic
977805985 4:101298404-101298426 GAAAAAAATTCATGTATAAGTGG - Intronic
977821815 4:101480510-101480532 GAAGAAAATCAATGAATCAATGG - Intronic
978148513 4:105406764-105406786 GAAAGAAATCCATGTATAAGTGG + Intronic
978243584 4:106546087-106546109 GAAGAAAATCTACATATAAGTGG + Intergenic
978285181 4:107069118-107069140 GAAAATAATCTACGTGTAAGTGG + Intronic
978556326 4:109984636-109984658 GAAAAAAATCCAGGTATAAGTGG + Intronic
978657715 4:111085205-111085227 AAAGAAAATTCATGTATTAGTGG - Intergenic
978723995 4:111948717-111948739 GAAGAAAATCAATATTTAATTGG - Intergenic
978872739 4:113599948-113599970 GAGGAAAATCCACGTATAAGTGG + Intronic
978935600 4:114371349-114371371 GAAGAAAATCTGTATATAAGTGG - Intergenic
979125926 4:116971301-116971323 GAAGAAAATCCATGTTTAGGTGG + Intergenic
979490162 4:121317091-121317113 GAAGAAAATATTTGAATAAATGG + Intergenic
979535754 4:121818612-121818634 GAAAAAAATCCATGTGTAAGTGG + Intronic
979601403 4:122590074-122590096 GAAAAAAATTCATGTATAAGTGG - Intergenic
979613717 4:122718093-122718115 TAAGAAAATCCATGTAGAGGAGG + Intergenic
979738207 4:124116292-124116314 GAAGAAAATTCACATATAAGTGG - Intergenic
979814696 4:125086375-125086397 GAAGAAAAGCCACATATAAGTGG - Intergenic
979863788 4:125727646-125727668 GAAAAAGATCTGTGTATAAATGG + Intergenic
980081000 4:128343995-128344017 GAAGAAAATCTGCATATAAATGG + Intergenic
980307963 4:131089350-131089372 GAAGAAGATTTATGTATATCAGG - Intergenic
980319101 4:131244556-131244578 CATGAAAATCTATGTAGAACAGG + Intergenic
980445244 4:132897536-132897558 GAAATAAATCTATGTACAAGTGG - Intergenic
980701520 4:136438118-136438140 TAAGAAAATTTATGTATGAGCGG - Intergenic
980827050 4:138086645-138086667 GAAGAATGTCTTTGTAGAAGTGG - Intergenic
980907560 4:138963036-138963058 GAAGAAAATCCACTTATAAGTGG + Intergenic
980977972 4:139629245-139629267 AAAAAAAATCCAAGTATAAGTGG - Intergenic
981041338 4:140225146-140225168 GAAGAAAGTCCATGTATAAGTGG + Intergenic
981114539 4:140974892-140974914 GAAAAAAATCCATGTATTAGCGG - Intronic
981157270 4:141453785-141453807 GAAAGAAATCTATGTATATATGG - Intergenic
981205814 4:142038702-142038724 GAGGAAAATTTATGATTAAGTGG + Intronic
981248510 4:142569879-142569901 ACAGAAAATTTATGTATGAGAGG - Intronic
981267634 4:142805525-142805547 GAAGAAAATCTGCATGTAAGTGG - Intronic
981498720 4:145423175-145423197 GAAGAAAATCTGCATATAAATGG + Intergenic
981505652 4:145496550-145496572 GAAAAAAATCTGAGTATAAGTGG - Intronic
981666625 4:147234302-147234324 GAAAACAATCCATGGATAAGTGG + Intergenic
981856435 4:149298967-149298989 GAAAAAAATGTGTGTATAAGCGG + Intergenic
982073891 4:151719724-151719746 GAAGAAAATGTATGCAGCAGTGG + Intronic
982248980 4:153385358-153385380 GCAGAAAATCCAGGTTTAAGAGG + Intronic
982308626 4:153960424-153960446 GAAAAACATCCATGTATAAATGG + Intergenic
982346172 4:154362625-154362647 GAAAACTATCTGTGTATAAGTGG - Intronic
982571384 4:157054451-157054473 TAAAAAATTCTGTGTATAAGAGG - Intergenic
982591211 4:157314095-157314117 GAAGAAAATCCATGTATAAGTGG + Intronic
982650442 4:158081789-158081811 GAAGAATATATATATAAAAGAGG - Intergenic
982749721 4:159145700-159145722 ATAGAAAATATATGTTTAAGAGG + Intronic
982769385 4:159381970-159381992 GAAGAAAATCCAGGTATAAGTGG + Intergenic
982815826 4:159883153-159883175 GAAGAAAATCCATGTGTAAGTGG - Intergenic
982837379 4:160137288-160137310 GGAGAAAATCTGTGTATAAGTGG + Intergenic
982912549 4:161162984-161163006 GAAAAAAATCCCTATATAAGTGG - Intergenic
982980065 4:162121769-162121791 GAAGAAAATTTGTGTATAAATGG - Intronic
983112461 4:163769885-163769907 GAAGAAAATGCACATATAAGTGG - Intronic
983283295 4:165708200-165708222 GAAGCAAATCTGCATATAAGTGG - Intergenic
983331060 4:166330257-166330279 GAAAAAAATATCTGTATAGGTGG + Intergenic
983344849 4:166515117-166515139 GAAGAAAATCCATGTATAAGTGG + Intergenic
983539664 4:168895713-168895735 GAAGAAAATCCATATATAAGTGG + Intronic
983620380 4:169755316-169755338 AAAAAAAATTCATGTATAAGTGG - Intronic
983791752 4:171807396-171807418 GAACAAAATCTGTGTAGAAGTGG + Intergenic
983868868 4:172801808-172801830 GAAGAAAATCCATGCATAAGGGG - Intronic
983930918 4:173452414-173452436 GAAGAAAATCCACATACAAGTGG + Intergenic
983933773 4:173481515-173481537 GAAAAAAATCCACATATAAGCGG - Intergenic
984047917 4:174825007-174825029 GAAGAAAAACTATATAGAAGAGG + Intronic
984156282 4:176199146-176199168 GAAGAAAATCCACATATTAGTGG - Intergenic
984251382 4:177339611-177339633 GAAAAAAATCTGCGTATAAGTGG + Intronic
984342493 4:178475248-178475270 GAAAAAAATCCATATATAAGTGG - Intergenic
984379252 4:178969279-178969301 GAAGAAAATCTGTTTTTAAGTGG + Intergenic
984433113 4:179674052-179674074 GAAGAAAGTGAATGTAAAAGAGG - Intergenic
984438339 4:179733451-179733473 GAAGAAAATCCATGTAAAAGTGG + Intergenic
984546678 4:181112905-181112927 GAAAAAAAAAGATGTATAAGAGG - Intergenic
984639605 4:182146559-182146581 GAAAAAAATCTTTGATTAAGAGG - Intronic
984662789 4:182391384-182391406 GATGAAAAATTATATATAAGTGG - Intronic
984864245 4:184267723-184267745 GAAGAATATCCATGTGTAGGTGG + Intergenic
984902100 4:184594583-184594605 GAAGAAAATCCATGTATAAGTGG + Intergenic
986696308 5:10358642-10358664 GAAAAAAATCCATGTGTAAGTGG - Intronic
986841730 5:11705462-11705484 TATGAAAATATATGTATATGTGG + Intronic
986998372 5:13633333-13633355 GAAAAAAATCCATATATAAATGG + Intergenic
987428624 5:17803602-17803624 AAAAAAAATCCATGTATAAGTGG + Intergenic
987436505 5:17901271-17901293 GAAAAAAATCTATCAAAAAGTGG - Intergenic
987448149 5:18047369-18047391 GAAGAAAATCTGCATATAAGTGG + Intergenic
987455125 5:18134814-18134836 GAAAAACATCTGTGTCTAAGTGG - Intergenic
987511285 5:18843267-18843289 AAATAAAATCTATGTATTAAGGG + Intergenic
987553961 5:19421211-19421233 GCAGAAAATTCATGTATATGTGG + Intergenic
987668554 5:20978088-20978110 GAAAAAAATATATATATACGTGG + Intergenic
987728908 5:21742267-21742289 GAAGAAAATCTACAAATAAGTGG - Intergenic
987734056 5:21816114-21816136 GAGGAAAATCCACATATAAGTGG - Intronic
987745646 5:21968337-21968359 TGAGAAAATCAATGTAAAAGAGG + Intronic
987843462 5:23251998-23252020 GAATAAAATATATGTGTAAGTGG - Intergenic
987906024 5:24078359-24078381 GAAGAAAATCCATACATAAGTGG + Intronic
987906223 5:24081058-24081080 AAAAAAAATCCACGTATAAGTGG - Intronic
988030500 5:25757367-25757389 GAAGAAAATCTACATATAAGTGG + Intergenic
988112911 5:26846698-26846720 GAAGAAAATCCACTTATGAGTGG + Intergenic
988118682 5:26930507-26930529 GAAAAAAATCTGCATATAAGTGG + Intronic
988155616 5:27445935-27445957 AAAGAAAATCGATATATCAGAGG - Intergenic
988285966 5:29216388-29216410 GAAGAAAATCCAAATATATGTGG - Intergenic
988324571 5:29746158-29746180 GAAAAAACTATATGTAGAAGGGG - Intergenic
988362803 5:30256905-30256927 GAAGAAAATCTTCTTACAAGTGG + Intergenic
988445314 5:31279749-31279771 GAAGAAAATCTAAGTATAAGTGG + Intronic
988530582 5:32023789-32023811 GAAGCAAAACTCTGGATAAGGGG - Intronic
988669452 5:33365334-33365356 GAAGAAACTCCGTGTGTAAGTGG - Intergenic
988670925 5:33380601-33380623 GAAGAAATTATATGGATGAGAGG - Intergenic
988718568 5:33853123-33853145 GATTAAAATCTATGTGTAACAGG - Intronic
988822476 5:34901253-34901275 GAAAAAAATCTGTGTATAAGTGG + Intergenic
988940212 5:36138205-36138227 TAAGAACCTGTATGTATAAGTGG + Intronic
988954164 5:36297361-36297383 GAAGAAAATCCACATATAAGTGG + Intronic
989051699 5:37326897-37326919 GAAAAAAATCTGTGTATAAGTGG - Intronic
989280187 5:39632319-39632341 GAAAAAAATCCTTTTATAAGTGG - Intergenic
989483733 5:41963780-41963802 GAATAAAATCCATGTATATGTGG + Intergenic
989591454 5:43116970-43116992 GAAGAAAATAAAAGTACAAGAGG - Intronic
989647754 5:43654154-43654176 GAAGAAATACTATGTATCAGTGG + Intronic
989650074 5:43678231-43678253 GAAGAAAATCTGTGGATAAGTGG + Intronic
989714483 5:44445226-44445248 GAATAAAATCTGTGTATAAGTGG + Intergenic
989783589 5:45300322-45300344 GAAGAAAATCCACCTATAAATGG - Intronic
989804799 5:45590020-45590042 AAAGGAAAAATATGTATAAGTGG - Intronic
989989675 5:50746656-50746678 GAAAAAAATATATATATCAGAGG - Intronic
990186710 5:53218019-53218041 GAAGAAAATTTGTGTACAGGTGG + Intergenic
990249452 5:53898162-53898184 GAAGAAAATCTGCATATAAGTGG + Intronic
990571007 5:57078829-57078851 GAAGAAAATCTGTGTCTAAGTGG + Intergenic
990588238 5:57233749-57233771 GAAGAAAATCTAGATGTAAGTGG + Intronic
990628653 5:57642474-57642496 GAAGAAAGTGTATGCATCAGGGG + Intergenic
991058781 5:62349092-62349114 AAAAATAATCCATGTATAAGTGG - Intronic
991098376 5:62763753-62763775 GAAGAAAATCCATCTGTAAGTGG + Intergenic
991229645 5:64317083-64317105 GAAAAAAATCCACATATAAGTGG + Intronic
991397047 5:66215016-66215038 GAAGAAAATCCACATAAAAGTGG - Intergenic
991563961 5:67985315-67985337 GAAAAAAATCTTCATATAAGTGG + Intergenic
991650776 5:68850608-68850630 GAAAAAAATCTGCCTATAAGTGG - Intergenic
991724211 5:69519885-69519907 GAAAAAAATCCACGTATATGTGG + Intronic
991765844 5:69978465-69978487 TGAGAAAATCAATGTAAAAGAGG + Intergenic
991781478 5:70139697-70139719 TGAGAAAATCAATGTAAAAGAGG - Intergenic
991845080 5:70853537-70853559 TGAGAAAATCAATGTAAAAGAGG + Intergenic
991873921 5:71140011-71140033 TGAGAAAATCAATGTAAAAGAGG - Intergenic
992485995 5:77195912-77195934 GAAGAAAATCTGCGTGTAAGTGG + Intergenic
992542936 5:77782302-77782324 GAAAAAAATCTACATATGAGTGG + Intronic
992792046 5:80222438-80222460 GAAGTAAATCTCTGTTTCAGAGG - Intronic
992813374 5:80411619-80411641 GAAGAGAATATATTTAGAAGAGG - Intronic
993315220 5:86395530-86395552 CAGGAAAATCCATGTGTAAGTGG + Intergenic
993517069 5:88850819-88850841 GAAGAAAATTCATGTGTAAGTGG - Intronic
993596335 5:89860911-89860933 GAAAAAAATCCATGTATAAATGG + Intergenic
993708814 5:91201718-91201740 GAAGAAAATCCGTGTATAAGTGG - Intergenic
993991655 5:94665293-94665315 GAAAAAAATTCATGTGTAAGTGG + Intronic
994031774 5:95151451-95151473 GAAGAAAATCCATGTATAAGTGG + Intronic
994129944 5:96215572-96215594 GAAAAAAATCCATGTATAAGTGG - Intergenic
994441491 5:99811131-99811153 TTGAAAAATCTATGTATAAGTGG - Intergenic
994805307 5:104439545-104439567 GAAGAAAATCTGCCTATAAGTGG + Intergenic
994846743 5:104998653-104998675 GAAGAAAGTCAATCTATAAATGG - Intergenic
994922278 5:106062553-106062575 GAAGAAAATCTGCATACAAGTGG - Intergenic
995025733 5:107420024-107420046 TAAGAAAAACTATGTAAAAAAGG + Intronic
995164151 5:109018291-109018313 GAAGACAATCTATTTCTAAGTGG - Intronic
995168256 5:109073780-109073802 GAAAAAAATCCACATATAAGTGG + Intronic
995609830 5:113897681-113897703 GAAAAAGATCCATGTATAAGTGG - Intergenic
995650987 5:114368037-114368059 AAAAAAAATCTGTGTATAAGTGG - Intronic
995673842 5:114639770-114639792 GAAGAAAATCTACATATAAGTGG + Intergenic
995807147 5:116065742-116065764 GAAGAAAATCTGTGTATATGTGG + Intergenic
995830735 5:116352600-116352622 GAAAAAAATCCATCTATAAGTGG + Intronic
996005696 5:118418660-118418682 GATGAAGATCCGTGTATAAGTGG + Intergenic
996009579 5:118466703-118466725 GAAGAAAATATACTTAAAAGTGG - Intergenic
996091743 5:119358085-119358107 AAAAAAAAGCTACGTATAAGAGG - Intronic
996156593 5:120110354-120110376 GAAGAAAATCCCTGTGTAAGTGG + Intergenic
996173669 5:120328698-120328720 GAAGAATTTCTATTTTTAAGTGG + Intergenic
996557625 5:124795489-124795511 AAAAAATATCCATGTATAAGTGG + Intergenic
996611035 5:125380895-125380917 GAAGAAAATCCACGTGTAAGTGG + Intergenic
996844711 5:127886428-127886450 GAAGGAAATCTGGGTATAAGTGG - Intergenic
996848526 5:127927799-127927821 GAAGAAAATCTATCCATTATAGG - Intergenic
996922840 5:128788961-128788983 GAAGATAATCTGTGGATAAGTGG + Intronic
997147920 5:131457567-131457589 GAAAAAAATCTGCATATAAGTGG - Intronic
997308423 5:132858014-132858036 TAAGAAAATATATTTAAAAGTGG + Intergenic
997913482 5:137899843-137899865 GAAAAAAATCCATATCTAAGTGG - Intronic
997924473 5:138015914-138015936 AATGATTATCTATGTATAAGTGG + Intronic
998194747 5:140058655-140058677 GAAAAAAATCTGTGTATATGTGG - Intergenic
998668251 5:144323741-144323763 GAAGAAAATCTTTCTATATGTGG - Intronic
998895132 5:146790727-146790749 GAAGAAAATCTAGGTGTCTGAGG - Intronic
998989239 5:147796903-147796925 GAAGCAAAACTAAGGATAAGGGG - Intergenic
999011422 5:148045144-148045166 GAAAAAACTCTGTGTATAAATGG + Intronic
999044850 5:148455979-148456001 GAAGAAAATCCATGCGTAAGTGG + Intronic
999165303 5:149544637-149544659 GAAAAAAACCTGTGTACAAGTGG - Intronic
999170866 5:149593864-149593886 GAAGAAATTCTGTGTATAAGTGG + Intronic
999505269 5:152188149-152188171 GAAAAAAATCTATGTCTAAGTGG + Intergenic
999876839 5:155816544-155816566 GAAGAAACTCTACATATAAGTGG + Intergenic
999993866 5:157073196-157073218 GAAAAAAATCTGCGAATAAGTGG - Intergenic
1000266081 5:159639722-159639744 GGAGAATATCCATGTATAAGTGG + Intergenic
1000493762 5:161951380-161951402 TAAAAATATCCATGTATAAGTGG + Intergenic
1000512588 5:162202311-162202333 GAAAAAAATCCATATATAAGTGG + Intergenic
1000664283 5:163975580-163975602 GAAGAAAATCCATGAATAAGTGG - Intergenic
1000700100 5:164438684-164438706 GAAAAACATCTGAGTATAAGTGG + Intergenic
1000776524 5:165426482-165426504 GAAGAAAATCCAAATATAAGTGG - Intergenic
1000801340 5:165730328-165730350 GAAGAAAATCCACGTATAAGTGG - Intergenic
1001032129 5:168270665-168270687 GAACAAAATCTATATGTATGTGG - Intergenic
1001285489 5:170420184-170420206 GAACAAAAGCCATGTGTAAGCGG - Intronic
1001345042 5:170887021-170887043 GAAAAAAATCCATGCATAAGTGG + Intronic
1001423257 5:171603125-171603147 GAAGAAAATCCATGTATAAGTGG + Intergenic
1001430081 5:171653135-171653157 GAAAAAAATCCATGCATAAGTGG + Intergenic
1001571036 5:172730797-172730819 GAAGAACATCCATGTAAGAGGGG - Intergenic
1001865585 5:175102059-175102081 GAAAAAAATCCTTATATAAGTGG + Intergenic
1001925393 5:175632624-175632646 GAAGAAAATCCACGTAGAAGTGG + Intergenic
1002019193 5:176351460-176351482 TAAGAAAATCAAAGTATAGGTGG + Intronic
1002766320 6:242006-242028 GAAAAAAATTCATGTATAAGTGG - Intergenic
1002803196 6:546536-546558 GAAGAAAATGCGTGTATAAGTGG - Intronic
1002842345 6:917076-917098 GAAGAAAATCTACATGTAAGTGG - Intergenic
1002913751 6:1511500-1511522 GAAGAAAATCCATGTCTAGGTGG - Intergenic
1003105949 6:3216071-3216093 GAAGAAAATCTTTGTATGCGTGG + Intergenic
1003232522 6:4267565-4267587 GAAAAAAATCCACGCATAAGTGG + Intergenic
1003261820 6:4524351-4524373 GAAGAAAATTCACATATAAGTGG - Intergenic
1003384514 6:5654775-5654797 GAAGAAAATCCACGTATAAGTGG - Intronic
1003664224 6:8094722-8094744 GAAGAAAATTTGTGTTTAAGTGG - Intronic
1003863971 6:10347050-10347072 GAAAAAAATCTACATATCAGTGG + Intergenic
1004034610 6:11911120-11911142 GAAGAAAATCTACGTATAACTGG + Intergenic
1004083654 6:12422135-12422157 GAAAAAAATCTGCGTAAAAGTGG - Intergenic
1004173190 6:13315187-13315209 GAAGAAAATCCATGTTTAAGGGG - Intronic
1004335863 6:14763906-14763928 GAAAAAAATCCATGAATAAGTGG - Intergenic
1004364614 6:15001151-15001173 AAAACAAATCCATGTATAAGTGG + Intergenic
1004446461 6:15704103-15704125 GAAAAAAATCTGCGCATAAGTGG - Intergenic
1004486728 6:16073210-16073232 GAAAAAAATCCGTGTATAAGTGG + Intergenic
1004584010 6:16982005-16982027 AAAGAAAATCCGTGTATAAGTGG + Intergenic
1005069289 6:21849667-21849689 GAAGAAAATCTGCCTATAAGTGG - Intergenic
1005335589 6:24792843-24792865 GAAGAAAATCTTCATATAAGTGG + Intergenic
1005635161 6:27746161-27746183 AAAAAAAATCCATGTATAAGTGG + Intergenic
1006688550 6:35859587-35859609 TAAAAAAATCTGTGCATAAGTGG + Intronic
1007058348 6:38911761-38911783 GAAGAAAATCTAAACAGAAGTGG + Intronic
1007089600 6:39174002-39174024 GAAGAAGATCCGTGTATAAGTGG - Intergenic
1007156182 6:39746548-39746570 GAAAAAAATCTCTGTATAAGTGG - Intergenic
1007175036 6:39890269-39890291 GAAGAAAATCCACATACAAGTGG + Intronic
1007732608 6:43957165-43957187 GAGAAAAATCCATGTATAAATGG - Intergenic
1007869876 6:45022925-45022947 GAAAAAAATCTGCATATAAGTGG + Intronic
1008096163 6:47341833-47341855 CAAGAAAATCTTTTTATAAGGGG - Intergenic
1008119112 6:47590508-47590530 GAAAAAAATCTGTGTATACGTGG - Intronic
1008124038 6:47648890-47648912 GAAGAAAACCCAAGTATAAATGG - Intergenic
1008532825 6:52480339-52480361 GAAGAAAATCCAAGTTTCAGTGG + Intronic
1008585984 6:52949908-52949930 GAAGAAAATTCATGTATAAGTGG - Intergenic
1008639792 6:53450104-53450126 GAAAAACATCTTTGTATAAGAGG - Intergenic
1008856125 6:56089540-56089562 GAAAAAAATCCACATATAAGTGG + Intronic
1008985725 6:57540475-57540497 GAAAAAAATCCACATATAAGTGG - Intronic
1009041363 6:58182804-58182826 AAAGAAAAACCATGCATAAGAGG - Intergenic
1009058890 6:58373684-58373706 GAAGAAAATCTGAGTGTAAGTGG + Intergenic
1009231952 6:61073429-61073451 GAAGAAAATCTGGGTATAAGTGG - Intergenic
1009311563 6:62159944-62159966 AAAGAAAATCCATGCAAAAGTGG + Intronic
1009439320 6:63657678-63657700 GAAGAAAATCGATGTATAAGTGG + Intronic
1009764837 6:68058677-68058699 GAAAAAAATGTATGTATATATGG - Intergenic
1009833749 6:68971476-68971498 GAAAAAAATCCACATATAAGTGG + Intronic
1009858990 6:69301031-69301053 GAAAAAAATCTACTTATAAGTGG - Intronic
1009988273 6:70808169-70808191 GAAGAAAATCCACATGTAAGTGG + Intronic
1010118785 6:72348238-72348260 CAAAAAAATTTGTGTATAAGCGG - Intronic
1010529641 6:76952018-76952040 GAAAATAATATGTGTATAAGTGG + Intergenic
1010729146 6:79369631-79369653 GAAAAAAATCTGCATATAAGTGG + Intergenic
1010800896 6:80174544-80174566 GAAAAAAATTTGCGTATAAGTGG + Intronic
1010819123 6:80392626-80392648 CAAGAAAATCAATTTATAAAAGG - Intergenic
1010947427 6:81993789-81993811 GAATAAAATTTAAGTGTAAGAGG + Intergenic
1011083147 6:83511361-83511383 AAAAAAAATCTGTGTATAAGTGG - Intergenic
1011376970 6:86698642-86698664 GAAACAAATCTATGCATATGTGG + Intergenic
1011636259 6:89376910-89376932 GAAGAAAATCCATGTATAAGTGG - Intronic
1011712842 6:90072066-90072088 GAAAAAAATCCACGTATATGTGG + Intronic
1011989684 6:93498800-93498822 CAAGAAAATTTATGTACAACTGG - Intergenic
1012051712 6:94354351-94354373 GAAGAAAATCTGCATATAAGTGG - Intergenic
1012107208 6:95178178-95178200 GAAGAAAATGTGTGTATGAGTGG + Intergenic
1012346076 6:98188125-98188147 GAATAAAATATATTCATAAGAGG + Intergenic
1012375361 6:98555550-98555572 GAAGAAAATCTGGGGATAGGTGG - Intergenic
1012787595 6:103651763-103651785 GAAGAAAGTTCATGTATAAGTGG + Intergenic
1012857039 6:104514333-104514355 GAAGAAAATCTATATATAAGTGG + Intergenic
1013059516 6:106619451-106619473 GCAGGAAATCCACGTATAAGTGG - Intronic
1013205667 6:107943516-107943538 GAAAAAAATCCACGTATAAGTGG + Intronic
1013353669 6:109328684-109328706 AAAAAAAATCTGTGTATCAGTGG - Intergenic
1013477014 6:110517965-110517987 GAAAAAAATCCACGTATAGGTGG - Intergenic
1013891239 6:115030472-115030494 GAAAAAAATCTGGATATAAGTGG - Intergenic
1013901144 6:115157071-115157093 AAAGAAAATTCATGTATAAGTGG - Intergenic
1014196079 6:118560539-118560561 AAAGAATATTCATGTATAAGTGG + Exonic
1014297182 6:119633654-119633676 AAAGAAAATATTTGTACAAGTGG - Intergenic
1014311825 6:119813249-119813271 AAAGAAAATCCAAATATAAGTGG + Intergenic
1014327924 6:120022693-120022715 AAAACAAATCTATGTATGAGTGG - Intergenic
1014534747 6:122601540-122601562 GAAGAAACTCTACAGATAAGTGG - Intronic
1014554258 6:122826585-122826607 GAAGAAAACCTGTGTATACACGG - Intergenic
1014648072 6:124000235-124000257 TAAGAAAATAGATGTATATGTGG - Intronic
1014751804 6:125265498-125265520 GAAGAAAATCTGCACATAAGTGG - Intronic
1014822597 6:126008577-126008599 GAAATAAATCTGAGTATAAGTGG - Intronic
1015081685 6:129233664-129233686 GAAGAAAATCCGCGTATAAATGG + Intronic
1015124950 6:129743645-129743667 GAAGAAAATTTATGAGTAAAGGG - Intergenic
1015168124 6:130221751-130221773 GAAGAAAATCTGCATGTAAGTGG + Intronic
1015233981 6:130949735-130949757 GAAGAAAATCTAGGTGTAAGTGG - Intronic
1015235987 6:130971747-130971769 AAAGCAAAACTATGAATAAGGGG + Intronic
1015255519 6:131175309-131175331 GAAAAATATCCATATATAAGTGG + Intronic
1015265770 6:131290834-131290856 GAAAAAAATTTGTATATAAGTGG - Intergenic
1015327212 6:131936766-131936788 GAAAAAAATTCATGTATAAGTGG + Intergenic
1015336239 6:132042436-132042458 GAAGAAAATTCATGTATAAGTGG + Intergenic
1015699475 6:136019958-136019980 GAAGAAAATCTACTTATAAGTGG + Intronic
1015803256 6:137081989-137082011 TAAGAAAAACTATGGAGAAGAGG + Intergenic
1015891205 6:137971266-137971288 GAAGAAAATCTGCATATAAGTGG + Intergenic
1016115720 6:140282850-140282872 GAATAAAATCTATCTTGAAGAGG - Intergenic
1016187222 6:141211831-141211853 GAAGAGAACCTATGAAAAAGGGG - Intergenic
1016236720 6:141877032-141877054 GAAAAAAATCTGTGTATAAGTGG + Intergenic
1016264574 6:142215963-142215985 CAAGACCATCTATATATAAGAGG - Intronic
1016427078 6:143946197-143946219 GAAAAATATTTGTGTATAAGCGG + Intronic
1016503659 6:144751647-144751669 GAAAAAAATCTGTGCATAAATGG + Intronic
1016725353 6:147358884-147358906 GAGGAAAATCCATGTGTAAGTGG + Intronic
1016873410 6:148840718-148840740 GAAAAAAATCTGCATATAAGTGG + Intronic
1016924288 6:149327104-149327126 GAAGCAAATATCTGTATAATAGG - Intronic
1017056140 6:150436890-150436912 GAAAAAAATCTGTGTATAAGTGG - Intergenic
1017057856 6:150454056-150454078 GGTGAAAATTTATGTCTAAGTGG - Intergenic
1017441665 6:154470019-154470041 AAAAAAAATCTACTTATAAGTGG + Intronic
1017984299 6:159429561-159429583 GAAAAAAATCTGCATATAAGTGG + Intergenic
1018014378 6:159698959-159698981 GAAGAAAATCTACATAGAAGTGG + Intronic
1018050231 6:160002558-160002580 AAAGAAAATCTGTGTATAAGTGG + Intronic
1018175962 6:161179608-161179630 GAAGAAAATCTGTATATAAGTGG - Intronic
1018217360 6:161541981-161542003 GAAGAAAATCTACATACAAGTGG - Intronic
1018220194 6:161570437-161570459 AGAAAAAATCTGTGTATAAGTGG - Intronic
1018304394 6:162439620-162439642 GAAGAAAATCTGCATATAAATGG - Intronic
1018344263 6:162884342-162884364 GAAAAAAATCCTTGTATAAGTGG + Intronic
1018562330 6:165114694-165114716 GAGGAAAGTCTATGTAACAGAGG - Intergenic
1018584554 6:165342259-165342281 GAAAAATATCTACATATAAGTGG + Intronic
1018861776 6:167715686-167715708 GAAGAAAATCCACATATAAGTGG + Intergenic
1019096826 6:169588507-169588529 GAAAAAAAATCATGTATAAGTGG + Intronic
1019844549 7:3484491-3484513 GAAAAATATCCTTGTATAAGTGG + Intronic
1020159481 7:5758482-5758504 GAAGAAAATCTGCAAATAAGGGG - Intronic
1020551527 7:9612354-9612376 AAAGAAAATCATTGTATAAATGG - Intergenic
1020597797 7:10231142-10231164 GAAGAAACTCAAAATATAAGTGG + Intergenic
1021085301 7:16415812-16415834 GAAACAAATGTATGTGTAAGTGG + Intronic
1021171188 7:17399599-17399621 GAAGAAAACCTACTTATAAGTGG + Intergenic
1021212658 7:17874184-17874206 GAAAAAAATCCACATATAAGTGG - Intronic
1021325536 7:19262353-19262375 GAAGGAAATCCACGTATAAGTGG + Intergenic
1021371663 7:19856562-19856584 TTTGAAAATCTTTGTATAAGTGG - Intergenic
1021383654 7:20001229-20001251 GAAGAAAATCTGCACATAAGTGG - Intergenic
1021482642 7:21134404-21134426 GAAATAAATCCATGTATAAGTGG - Intergenic
1021571585 7:22071179-22071201 GACAAAAATCTACATATAAGTGG - Intergenic
1021686563 7:23192714-23192736 GAAGAAAATCCCTGTACAAGTGG + Intronic
1021728592 7:23574530-23574552 GAAAAAAATATATGTATCAAGGG - Intergenic
1021759551 7:23890366-23890388 GAAAAAAATCCATGTAGAAGCGG - Intergenic
1022047711 7:26636033-26636055 GAAAAAAGCCCATGTATAAGTGG - Intergenic
1022146063 7:27542242-27542264 AAAAAAAATAGATGTATAAGTGG + Intronic
1022270195 7:28799649-28799671 TAAAAAAATCTATGTAGGAGTGG - Intronic
1022306694 7:29153345-29153367 GAAAAAAATCCGTGTATAAGTGG - Intronic
1022515598 7:30973287-30973309 GAAGAAAATCTATGTGTAAATGG + Intronic
1022751287 7:33228874-33228896 GAAGAAACTCCACGTATAAGGGG + Intronic
1023296777 7:38723195-38723217 GAAGAAAATCCATGTATAAGTGG + Exonic
1023316962 7:38948030-38948052 GAAAAAAATCCGTGTATAAGTGG - Intergenic
1023375463 7:39551138-39551160 GAAGAAAATCCGTGTATCAGTGG - Intergenic
1023409509 7:39875488-39875510 AAAGAAAATCAATGTATCAAAGG - Intergenic
1023489760 7:40726483-40726505 GGAGAAAACCCATGCATAAGTGG + Intronic
1023769979 7:43548354-43548376 GAAAAAAATCCATGTACGAGTGG + Intronic
1024052252 7:45633316-45633338 GAAAAAAATCCATGTATAAGTGG - Intronic
1024173294 7:46811814-46811836 GGAGAAAATCCATGTGTATGAGG + Intergenic
1024214423 7:47235202-47235224 AAAGAAAACCCATGTGTAAGTGG - Intergenic
1024233804 7:47382821-47382843 GAAAAAAATCTGCATATAAGTGG + Intronic
1024407209 7:48995517-48995539 GAAGAAAATGTGTGTCTATGTGG + Intergenic
1024413474 7:49075845-49075867 GAAGAAAATCCTTGTATAAGTGG + Intergenic
1024484667 7:49904625-49904647 GAATAAAAACCATGTAAAAGTGG - Intronic
1024749677 7:52450769-52450791 AAAGAAAATCCATGTACAAGCGG + Intergenic
1025136342 7:56417064-56417086 AAAGAAAATCAATGTATCAAAGG + Intergenic
1025235381 7:57231279-57231301 GAAGAAAATCTGCGTATATGTGG + Intergenic
1025271204 7:57519097-57519119 GAAAAAAATCCATGTATTAGTGG - Intergenic
1026176340 7:68001105-68001127 GAAAAAAATTCATGTATAAGAGG + Intergenic
1026221867 7:68405571-68405593 GAAGAAAATCATTGTGTATGTGG + Intergenic
1026257412 7:68724519-68724541 TAAAACAATCTGTGTATAAGTGG - Intergenic
1026523937 7:71138477-71138499 GAAAAAAATCTATGTACAGGTGG + Intronic
1026537176 7:71248407-71248429 GAAGAAAATCCATGTATAAGTGG + Intronic
1026542070 7:71288383-71288405 GAAGGAAATCCATGTAGAAGTGG + Intronic
1026605770 7:71814581-71814603 GAAGGAAATCCACATATAAGTGG - Intronic
1026677486 7:72439963-72439985 GAAAAAGATCCATGTATAAGTGG + Intronic
1027347364 7:77275131-77275153 GAAAAAAATCTGTGTATAAATGG - Intronic
1027880562 7:83829774-83829796 GAAGAATATGTAGGTAGAAGAGG - Intergenic
1027903424 7:84148677-84148699 GAAGAAAATACAAATATAAGTGG - Intronic
1028164985 7:87528502-87528524 GAAAAAAACCTACATATAAGTGG + Intronic
1028307452 7:89283819-89283841 GAAAAAAATCTATGTATAAGTGG - Intronic
1028394403 7:90351605-90351627 GAAAAATATCTGTATATAAGTGG + Intronic
1028606510 7:92661788-92661810 GAAAATAATCTGTATATAAGTGG + Intronic
1028956613 7:96700540-96700562 GAAAAAAATCTGTGTATAAATGG + Intronic
1029962371 7:104701636-104701658 TAAGAAAGTTCATGTATAAGCGG + Intronic
1029987011 7:104931542-104931564 GAAGAAAACCTATTCATTAGAGG + Intergenic
1029994394 7:104992874-104992896 GAAGAAAATTTGTGTATAAGTGG - Intergenic
1030235848 7:107261165-107261187 GAAAAATATCTGTGTATAAGTGG + Intronic
1030251365 7:107448741-107448763 GAAAAAAATCTGTGTATATGTGG - Intronic
1030308720 7:108047244-108047266 GAAAAAAATTTGTATATAAGTGG - Intronic
1030392443 7:108943684-108943706 GAAGAAAATCCATACATAATAGG - Intergenic
1030433032 7:109477023-109477045 AAAAAAAATCCATGTATAAAGGG + Intergenic
1031009374 7:116509629-116509651 AAAAAAAATCTGAGTATAAGTGG - Intergenic
1031050519 7:116940287-116940309 GAAGAAAATCCACGTATAAGTGG - Intergenic
1031200483 7:118677961-118677983 GAAGAAAATTTGTGTATAAGTGG - Intergenic
1031549794 7:123094775-123094797 GAAGAACATCCAAGTGTAAGTGG + Intergenic
1031565489 7:123291948-123291970 GAAGAAAATCCACCTATAAGTGG + Intergenic
1031786885 7:126044824-126044846 GAAGAAAAACTAAGTATAAGAGG + Intergenic
1032274014 7:130439052-130439074 GAAGAAAATCTGGGTATAAGTGG - Intronic
1032292785 7:130604137-130604159 GAAGAAAATCCATGTGTAAGTGG + Intronic
1032440557 7:131939844-131939866 AAAGAAAATTCATGTCTAAGCGG + Intergenic
1032730259 7:134634714-134634736 GAAGGAAATCCATGTGTATGTGG - Intergenic
1032765062 7:134983887-134983909 GAAGAAAATCCCTGTATACTTGG - Intergenic
1032774082 7:135091462-135091484 GAAAAATATCTGTGTATAAGTGG + Intronic
1032884639 7:136124471-136124493 GGAAAAGATCTCTGTATAAGAGG + Intergenic
1033187682 7:139243788-139243810 GGCAAAAATCTATTTATAAGTGG + Intronic
1033352483 7:140572916-140572938 GATGAAACTCCATGTAAAAGAGG + Intronic
1033543993 7:142383757-142383779 GAGGAAAATATATTTACAAGTGG + Intergenic
1033723738 7:144089380-144089402 AAAGAGAATTTATGTTTAAGGGG + Intergenic
1034047914 7:147949374-147949396 GAAGAAAATCCATGTATAAGTGG + Intronic
1034113593 7:148562635-148562657 GAAGAAAATCTGTATATAAGTGG - Intergenic
1034227020 7:149492166-149492188 GAAGAAAATCCATTTATAAGTGG - Intronic
1034686484 7:152975866-152975888 CAAGACAATGAATGTATAAGGGG - Intergenic
1034823572 7:154239344-154239366 GAAGAAAATCCACATATAAGTGG - Intronic
1034907741 7:154965498-154965520 GAAGAAAATCCAGCTATCAGTGG - Intronic
1035233234 7:157479088-157479110 GAAGAAAACCCGTGTATCAGTGG + Intergenic
1035308389 7:157948880-157948902 GAAAAAAATCTGCATATAAGTGG - Intronic
1035644021 8:1204764-1204786 GAAGAAAAAATCTGAATAAGAGG + Intergenic
1036200718 8:6769208-6769230 GAAGAAAATCTATGTCTTAGTGG + Intergenic
1036216690 8:6885641-6885663 GAAGAAAATCCATGTGTAAATGG - Intergenic
1036443938 8:8805589-8805611 GAAGAAAATCCTTCTGTAAGTGG + Intronic
1036657924 8:10689915-10689937 GAAGAAAATCTATGTGTAAGTGG + Intronic
1037189599 8:16107155-16107177 GTGGAAGATCCATGTATAAGTGG - Intergenic
1037208517 8:16355667-16355689 GAAGAAAATCCATATATAAGTGG - Intronic
1037215205 8:16442636-16442658 GAAGAAAACTTATATATAAGTGG - Intronic
1037242942 8:16798057-16798079 GAAAAAAATCCATATATAAGTGG - Intergenic
1037382569 8:18302984-18303006 GAAGAAAATCTGTGTGTAAGTGG + Intergenic
1037749258 8:21669593-21669615 GAAGAAAATCCGTGTATAAGTGG - Intergenic
1038170008 8:25122529-25122551 GAAAAAAATATATGTATGACTGG + Intergenic
1038698338 8:29826227-29826249 GAAGACAATCTATATACAGGTGG - Intergenic
1038954820 8:32456424-32456446 GGAGAAAATCCGTGTATAGGTGG - Intronic
1039180165 8:34858044-34858066 GGAGTCAATATATGTATAAGGGG + Intergenic
1039302098 8:36220958-36220980 CAAAAAAAGCTATGTATAAATGG - Intergenic
1039602192 8:38849008-38849030 GAAGAAAATCTACTTGTAAAAGG + Exonic
1039953223 8:42188188-42188210 GAAAAAAATCCATACATAAGTGG + Intronic
1040062699 8:43117499-43117521 GAAGAAAATCTGTGTGTAAGTGG + Intronic
1040453980 8:47577485-47577507 GAAAAAAATCTGTGTACAAGTGG - Intronic
1040636564 8:49281244-49281266 GAAGAAAATCTGGGTATAAGTGG + Intergenic
1040765123 8:50900339-50900361 GAAGAAAATTCATGTACAAGTGG + Intergenic
1041033514 8:53762820-53762842 TAAGAAAATCCATGTGTAAGTGG - Intronic
1041160521 8:55037832-55037854 GAAAAGAATCTGTGTATAAGTGG + Intergenic
1041236189 8:55805265-55805287 GAAAAAAATCTGGGTGTAAGTGG - Intronic
1041407748 8:57518875-57518897 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1041601860 8:59727938-59727960 AAAAAAAATTTATGTATAAATGG - Intergenic
1041612383 8:59866729-59866751 GAAGAAAATTCATGTATAAGTGG + Intergenic
1042054291 8:64747614-64747636 GAAGAAAATCCATGTATAAGTGG + Intronic
1042182634 8:66107104-66107126 GAAAAAAATCTATGTATGAATGG + Intergenic
1042193079 8:66207854-66207876 TGAGACAATATATGTATAAGTGG + Intergenic
1042664977 8:71194817-71194839 GAAGAAGATCCACGTATAAATGG + Intergenic
1042914217 8:73859117-73859139 GAAGAAAATCCATGTATAAGTGG - Intronic
1043077729 8:75723009-75723031 GAAGAAAATTTATGTATAAGTGG - Intergenic
1043115596 8:76249990-76250012 GAAGAAAATCTACATGTAAATGG - Intergenic
1043337773 8:79198353-79198375 GAAGAAAATTCACGTGTAAGTGG - Intergenic
1043625540 8:82253367-82253389 AAAAAAAATCCATGTACAAGTGG + Intergenic
1043962962 8:86438300-86438322 GAAGAAAATTCAAGTATAAGTGG + Intronic
1043980081 8:86627849-86627871 GAAGAAAATTCTTGTATAAGTGG - Intronic
1043986895 8:86704345-86704367 GAAGAAAATCCAGGGATAAGTGG + Intronic
1044064351 8:87681507-87681529 TAAGAAAATTTATTTCTAAGTGG + Intergenic
1044092046 8:88014449-88014471 GAAGAAAATCCATGCAAAAGTGG - Intergenic
1044154130 8:88822374-88822396 GATTATAATCAATGTATAAGAGG - Intergenic
1044281270 8:90359754-90359776 GAAGAGAACCTATGAATAAAAGG + Intergenic
1044489052 8:92790385-92790407 GAAGAAAAGCTATGTGTAAGTGG + Intergenic
1044526022 8:93251863-93251885 GAAAAAAATCTCCATATAAGTGG + Intergenic
1044642686 8:94401211-94401233 GAAAAAAACCCATATATAAGTGG - Intronic
1044650511 8:94489494-94489516 GAAGAAAATCCTCATATAAGTGG - Intronic
1044762210 8:95532420-95532442 GAAAAATATCTATGTATAAGTGG + Intergenic
1045048225 8:98299527-98299549 GAAGTACATCTATCTATATGTGG + Intergenic
1045218895 8:100177687-100177709 GAAAAAAATCCACATATAAGTGG + Intronic
1045668776 8:104523150-104523172 GGAAAAAATCCATGTATAAGTGG - Intronic
1045684430 8:104697425-104697447 GAAGGAAATATATGTATATATGG + Intronic
1045703280 8:104891893-104891915 GAAGAAACTCTATCTGTATGTGG - Intronic
1045769495 8:105718848-105718870 TAAGAAAATATATGTGAAAGAGG - Intronic
1045769951 8:105724935-105724957 GAAAAAAATCCACATATAAGTGG + Intronic
1046281649 8:112041106-112041128 GAAAAAAATCTATGTGCAAGTGG + Intergenic
1046837836 8:118822570-118822592 GAAGAAAATCCACATGTAAGTGG + Intergenic
1047299869 8:123604471-123604493 GAAGAAAATCTGTGTACCAGTGG + Intergenic
1047320282 8:123773018-123773040 GAAGAAAATCCCAGTGTAAGTGG + Intronic
1047491811 8:125381099-125381121 GAAGAAAATATATGTCTAAAAGG + Intergenic
1047541451 8:125770462-125770484 GCAAATAATCTGTGTATAAGTGG - Intergenic
1047664014 8:127070170-127070192 GATAAAAATCTATGTATAGGTGG - Intergenic
1047902438 8:129438124-129438146 GAAGAAAATTCCTGTATAAGTGG - Intergenic
1047992138 8:130297384-130297406 GAAGAAAATCCACATATAAGTGG + Intronic
1048684930 8:136893917-136893939 GAAGAAAATCCATATATGAGTGG - Intergenic
1049816668 8:144606292-144606314 GAAGAAAATCCATGTATATGTGG - Intergenic
1049837038 8:144742913-144742935 GAAAAAAATCCACATATAAGTGG + Intronic
1049995040 9:1026712-1026734 GAAAAAAATCTTTGGAAAAGTGG + Intergenic
1050002410 9:1092074-1092096 GAAAAAAATCCACATATAAGTGG - Intergenic
1050014137 9:1215505-1215527 GGAGAAAATCCATCTACAAGTGG + Intergenic
1050447222 9:5737989-5738011 GAAGAAAATACATGTATAAGTGG + Intronic
1050846301 9:10224694-10224716 GAAGAAAATGTGTGTGTCAGTGG - Intronic
1050935495 9:11389827-11389849 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1050975344 9:11929826-11929848 GCAGAAAACCTATGCATAAGTGG - Intergenic
1050975903 9:11937751-11937773 GAAAAAAATCCACATATAAGTGG - Intergenic
1051119764 9:13739263-13739285 GATGAAAAACTTTGGATAAGTGG - Intergenic
1051235643 9:14995798-14995820 AAAAAAAATTCATGTATAAGTGG + Intergenic
1051318087 9:15865450-15865472 GAAGAAGATCCACGTATAAGTGG - Intronic
1051360796 9:16279919-16279941 GAAGAAAATCCACTTATAAGTGG + Intergenic
1051489698 9:17647856-17647878 GAAGAAAATCTGCATATAAGTGG - Intronic
1051497075 9:17735500-17735522 AAAAAAAATTCATGTATAAGTGG - Intronic
1051562854 9:18462035-18462057 AAAAAAAATCTGTGTATAAGTGG + Intergenic
1051782702 9:20707737-20707759 GAAGAAAAGCCACGTATAAGTGG + Intronic
1051840467 9:21392014-21392036 GAAGTAAATCCACTTATAAGTGG + Intergenic
1052086593 9:24274613-24274635 AAAAAAAATCTACATATAAGTGG - Intergenic
1052111023 9:24581665-24581687 TAAGAAAATCTATGAAAAAAAGG + Intergenic
1052170383 9:25388199-25388221 TAAGAAATTCTGTGTATAATGGG + Intergenic
1052285409 9:26779091-26779113 GAAGCAAAACCATGAATAAGAGG - Intergenic
1052479534 9:29005775-29005797 GATAAACATCTATGTATAATTGG + Intergenic
1052559430 9:30065473-30065495 GATGAAAATTTGTGTATAAGTGG + Intergenic
1052609390 9:30752290-30752312 GCAGATAGTCTATGAATAAGTGG - Intergenic
1052617952 9:30866978-30867000 GAAGAAAATTCACGTATAAGTGG - Intergenic
1052897931 9:33765791-33765813 AAAGCAAATCCATGGATAAGGGG + Intronic
1052968082 9:34357044-34357066 GAAGAAAATCTGCCTATAAGTGG + Intergenic
1052988964 9:34507579-34507601 GAAGAAAACCTGTGTATAGTTGG + Intronic
1053038891 9:34852003-34852025 GAAGAAAATCCACAAATAAGTGG - Intergenic
1053771609 9:41485561-41485583 GTAGAAAATATATATATAAATGG + Intergenic
1054315243 9:63576199-63576221 GTAGAAAATATATATATAAATGG - Intergenic
1054785100 9:69202818-69202840 GAAAAAAACCCATGGATAAGTGG + Intronic
1054946395 9:70800504-70800526 GAAGAAAATCTACATATAAGTGG - Intronic
1055183315 9:73417547-73417569 GAAGTAAATCTATTTAAAGGTGG - Intergenic
1055194290 9:73568549-73568571 TAAAAAAATCTAAGAATAAGGGG - Intergenic
1055413769 9:76060513-76060535 GAAGAAAATCCATATATAAGTGG + Intronic
1055519185 9:77063074-77063096 GAAAAAAATCTTTGTATAAGTGG - Intergenic
1055739891 9:79376445-79376467 GAAGAAAATCCACATGTAAGTGG + Intergenic
1055998101 9:82183808-82183830 GAAGCAAAACCATGAATAAGGGG - Intergenic
1056085052 9:83139666-83139688 GAAGAAAATCCATATATAAGTGG + Intergenic
1056258083 9:84820669-84820691 GAAAAAAATTTGTGTATAAGCGG + Intronic
1056464680 9:86842196-86842218 GGAGAACATCTATGTATAAGTGG - Intergenic
1056964460 9:91154480-91154502 GAAGAAAATCTGCATATAAGTGG + Intergenic
1057505310 9:95628462-95628484 GAAGGAAAACCATGTACAAGTGG - Intergenic
1057558329 9:96107401-96107423 GAAAAAAATTCATGTATAGGTGG + Exonic
1057736444 9:97666028-97666050 GAAGAAAACCCATGTGTAAATGG + Intronic
1058277060 9:103056748-103056770 GAATAAAATCTGCGTATTAGTGG - Intergenic
1058320374 9:103622539-103622561 GAAGAATACTTATGTATAAGTGG - Intergenic
1058392656 9:104513453-104513475 GAAGAAAATCCATGCATAAGTGG - Intergenic
1058511004 9:105716639-105716661 GAAGAAAATCTGCACATAAGTGG - Intronic
1058579972 9:106445044-106445066 GAAAAAAATTCATGTATAAGTGG - Intergenic
1058581537 9:106464020-106464042 AAAGAAGATCTGTGTGTAAGTGG - Intergenic
1058607326 9:106736736-106736758 GAAGACAGTCTATGTTTGAGGGG + Intergenic
1058660957 9:107268341-107268363 GAAGATAATTCATGTATAAGTGG - Intergenic
1058735779 9:107892815-107892837 GAAGAAAATCCACATGTAAGTGG + Intergenic
1059024663 9:110613055-110613077 GAAAAAAGTCTGTGTATAAGTGG + Intergenic
1059572094 9:115449639-115449661 GAGGAAAATCTTTGAATACGTGG - Intergenic
1059947361 9:119424188-119424210 GAAAAAAATCCACGTAAAAGTGG + Intergenic
1060005546 9:119996558-119996580 AAAGAAAATCTGTGTCAAAGTGG + Intergenic
1060371827 9:123080902-123080924 GAAAAAAATCCACGTATAAGTGG - Intronic
1060452342 9:123755107-123755129 AAAAAAAATCTGTGTATAACTGG - Intronic
1060711996 9:125876350-125876372 GAAGGAAATCAGAGTATAAGTGG - Intronic
1061644353 9:131988384-131988406 GAAGAAAATCTGAGTATAAGTGG - Intronic
1185720620 X:2378394-2378416 GAAGAAAATCCACATATAAGGGG - Intronic
1185797266 X:2977125-2977147 GAAGAAAATTCTTGTATAAGTGG - Intergenic
1185843774 X:3417881-3417903 GAAGAAAATCCACATATTAGTGG + Intergenic
1185948700 X:4406365-4406387 GAAGGAAATCCACGTATAAGTGG + Intergenic
1186029218 X:5348547-5348569 GAAGAAAATCCATGCATGAGTGG - Intergenic
1186040005 X:5465518-5465540 GAAGAAAATCCTTATATAAGTGG - Intergenic
1186089931 X:6035685-6035707 GAAGAAAATCCACATATAAGTGG - Intronic
1186219947 X:7339823-7339845 TAAGAAAATATATGTTTAATAGG - Intronic
1186288873 X:8074763-8074785 GAAGAAACTCTGTGTATAAGTGG - Intergenic
1186304422 X:8240155-8240177 GAAGAAAATCCATGTATGAGTGG + Intergenic
1186307520 X:8278686-8278708 GAGGAAAATCAATGATTAAGTGG + Intergenic
1186321390 X:8429359-8429381 GAAGAAAATCCTCATATAAGTGG + Intergenic
1186368775 X:8925428-8925450 GAAGAAAATCCACGTATAAGTGG + Intergenic
1186381404 X:9064033-9064055 GAAGGAAATCCACTTATAAGTGG - Intronic
1186405215 X:9295875-9295897 GAAGAAAAATTACGTATAAGTGG - Intergenic
1186538191 X:10371633-10371655 AAAAAAAATCAGTGTATAAGTGG - Intergenic
1186645437 X:11501894-11501916 GAAGAAAATCTACATACAAGTGG + Intronic
1186729998 X:12399784-12399806 GAAGAAAATTCATATATAAGTGG + Intronic
1186737620 X:12482139-12482161 GAACAAAATCTGTGTATAAGTGG + Intronic
1186748099 X:12591412-12591434 GAAGAAAATCCATGTATATGTGG + Intronic
1186749739 X:12609255-12609277 GAAGAAAATCTATGTATAAGTGG + Intronic
1186812618 X:13205174-13205196 GAAGAAAATCTACATATAAGTGG + Intergenic
1187453025 X:19415613-19415635 AAAAAAAATCCATGTATAAGTGG - Intronic
1187489017 X:19732498-19732520 GAAAAAAATCTACATATAAGTGG + Intronic
1187538845 X:20170440-20170462 GAAGAAAATCCACGTGTAATTGG - Intronic
1187984789 X:24798340-24798362 GAAGAACATTTATGTATAGGTGG - Intronic
1188357720 X:29212915-29212937 GAAGAAAATTCATGTGTAAATGG + Intronic
1188712900 X:33423803-33423825 GAAAAAAATCCACATATAAGCGG + Intergenic
1188842151 X:35029336-35029358 TAAAAAAATCTGTGTGTAAGTGG + Intergenic
1188902072 X:35746080-35746102 GAAAAAAATCCACATATAAGTGG - Intergenic
1188919125 X:35949926-35949948 GAAGATCATCAGTGTATAAGTGG + Intronic
1189192933 X:39126549-39126571 GAAGAAAATCCACGTACAAGTGG - Intergenic
1189512888 X:41681050-41681072 GAAAACAATCCATGTATAAGTGG - Intronic
1189558579 X:42169876-42169898 GAAGAAAATCTGTGTCTAAGTGG + Intergenic
1189602190 X:42639135-42639157 GAAGAAAATCTGCATCTAAGTGG - Intergenic
1189623464 X:42869478-42869500 TAGGAAGATCTATGTATAACAGG + Intergenic
1189825553 X:44913053-44913075 GAAGAAAATCCGTATGTAAGTGG - Intronic
1189899651 X:45692965-45692987 GCAGAAACTCTATGTATATGTGG - Intergenic
1189979774 X:46497501-46497523 GAAGAAAATCCACATATAAGTGG + Intergenic
1190823879 X:53999159-53999181 GAAGAAAATCTGCATATAAACGG - Intronic
1190838721 X:54126357-54126379 GAAAAAAATTTGTGCATAAGTGG - Intronic
1191025746 X:55911285-55911307 GAAGAAAATCCATGTATAAGTGG + Intergenic
1191076863 X:56463317-56463339 GAAGAAAATATTTGTATGATTGG - Intergenic
1191102482 X:56746827-56746849 GGAGAAATTCTAAGTATGAGAGG - Intergenic
1191162583 X:57347195-57347217 CAACAAAATCTATGCATCAGTGG - Intronic
1191730255 X:64326234-64326256 GAAGAAAATCCACATATAAATGG + Intronic
1192113810 X:68392106-68392128 GAAGAAAATCTTCATATAAGTGG - Intronic
1192459956 X:71308512-71308534 GAAGAAAATCCACATATAAGTGG + Intergenic
1193319814 X:80108030-80108052 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1193694048 X:84685054-84685076 GAAAAAAATCCACATATAAGTGG - Intergenic
1193738700 X:85191835-85191857 GAAGAAAATCTGTGTAAAAGTGG + Intergenic
1193744645 X:85261148-85261170 GAAGAAAATTCATGGATAAGTGG + Intronic
1194190043 X:90824222-90824244 GAAGAAAATACATGTATAAGTGG + Intergenic
1194213153 X:91093719-91093741 AAAGAAAATCAATGTCTATGAGG - Intergenic
1194276340 X:91888294-91888316 GAAGTAAATCAATATATAATTGG - Intronic
1194312764 X:92334017-92334039 GAAAAAAATCAACGTATAACTGG - Intronic
1194490445 X:94539838-94539860 GAAGAAAATCTGTATATAAGTGG + Intergenic
1194573941 X:95588049-95588071 GAAGAAAATTCATGTATAAATGG + Intergenic
1194936740 X:99959353-99959375 GAAAAAAATCTGCATATAAGTGG - Intergenic
1195207269 X:102614676-102614698 GAAGAAAATCTGCATATAAGTGG - Intergenic
1195603673 X:106777546-106777568 GAAGAATATCCGTGTAAAAGTGG - Intronic
1195873642 X:109514635-109514657 GAAGAAAATCCATGTATATATGG + Intergenic
1195893594 X:109722371-109722393 AAAGAAAATCTAGGTATCTGTGG - Intronic
1196115825 X:111998637-111998659 AAAAAAAATGTGTGTATAAGTGG - Intronic
1196346487 X:114665848-114665870 AAACAAAATCTGTGCATAAGTGG + Intronic
1196476827 X:116097069-116097091 GAATAAAAGCTGTGCATAAGTGG + Intergenic
1196964023 X:121036078-121036100 AAAGCAAAACTGTGTATAAGGGG + Intergenic
1197037641 X:121895741-121895763 GGAGAAAATCCATGTATAAGTGG - Intergenic
1197114163 X:122812600-122812622 GAAGAAAACCTGCATATAAGTGG - Intergenic
1197155475 X:123265611-123265633 GAGAAAAATCCGTGTATAAGTGG + Intronic
1197308745 X:124878073-124878095 GAAGAAAATGTATGTATAAGTGG + Intronic
1197336681 X:125217450-125217472 AAAGCAAATCCATGAATAAGAGG + Intergenic
1197354206 X:125416031-125416053 GGAAAAAATCCATGTATAAGTGG - Intergenic
1197537182 X:127705229-127705251 GGAGAAAATCCACGTATAGGTGG + Intergenic
1197731695 X:129816129-129816151 GAAACAAATCCATGTACAAGTGG - Intronic
1197945046 X:131829743-131829765 GAAGTAAATATATATATAATAGG - Intergenic
1198483245 X:137060447-137060469 GAAGAAAATCTATGTATAAGTGG - Intergenic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1199072267 X:143491143-143491165 AAAAAATATCTGTGTATAAGTGG - Intergenic
1199279646 X:145985897-145985919 GAAGAAAATTGACGTGTAAGTGG + Intergenic
1199418381 X:147613962-147613984 GAAGAAAATCCACATGTAAGTGG - Intergenic
1199439983 X:147856917-147856939 GAAGAAAAGCTATGAAAAAAAGG + Intergenic
1199481811 X:148305935-148305957 GAAGAAACTCCATGTATAAGTGG - Intergenic
1199498894 X:148487450-148487472 GAATAAAATCCACGTATAAGTGG - Intergenic
1199568980 X:149248155-149248177 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1199605011 X:149570319-149570341 GAAGAAAATCCATGCATAAGTGG - Intergenic
1199641354 X:149865542-149865564 GAAGAAAGTTCATGTATAACTGG + Intergenic
1199727995 X:150603933-150603955 GTAGAAAATCTTTGGATAAAGGG + Intronic
1200341734 X:155404171-155404193 TGAAAACATCTATGTATAAGTGG + Intergenic
1200360020 X:155594898-155594920 GAAAAAATTCTGTGTATAAGTGG - Intronic
1200536642 Y:4406341-4406363 GAAGAAAATACATGTATAAGTGG + Intergenic
1200593642 Y:5110075-5110097 GAAGTAAATCAATATATAATTGG - Intronic
1200621031 Y:5448156-5448178 GAAAAAAATCAACGTATAACTGG - Intronic
1200843368 Y:7806398-7806420 GAATAAGATCCATGTATGAGGGG + Intergenic
1201895483 Y:18987798-18987820 GAAGAAAATTCATATGTAAGAGG - Intergenic
1202274885 Y:23106964-23106986 GAAGAAAATTCACATATAAGTGG - Intergenic
1202291143 Y:23313725-23313747 GAAGAAAATTCACATATAAGTGG + Intergenic
1202427877 Y:24740686-24740708 GAAGAAAATTCACATATAAGTGG - Intergenic
1202442914 Y:24929405-24929427 GAAGAAAATTCACATATAAGTGG + Intergenic