ID: 1122105986

View in Genome Browser
Species Human (GRCh38)
Location 14:99455286-99455308
Sequence TGCGATATGCATGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122105986_1122105991 -1 Left 1122105986 14:99455286-99455308 CCCACCCCATCATGCATATCGCA 0: 1
1: 0
2: 0
3: 9
4: 60
Right 1122105991 14:99455308-99455330 ATTTTCAACATGCAATGCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122105986 Original CRISPR TGCGATATGCATGATGGGGT GGG (reversed) Intronic
900828472 1:4945933-4945955 TTCTTTATGCATGATGGGGCTGG + Intergenic
907318487 1:53587960-53587982 TCCCAAATGCATGGTGGGGTCGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912974331 1:114314405-114314427 GCTGATATGCATGGTGGGGTGGG + Intergenic
913120806 1:115738887-115738909 TGCCAAAAGCAGGATGGGGTGGG - Intronic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
923254062 1:232204561-232204583 AGGGATATGGATGATGGGGTGGG + Intergenic
1070986595 10:80695045-80695067 TGGGATATGGAGGATGGGGTCGG + Intergenic
1072220486 10:93323657-93323679 TGGGATGTGTATGTTGGGGTTGG - Intronic
1075203776 10:120428743-120428765 TGCGGCATCCATGATGGGGACGG + Intergenic
1075985050 10:126777998-126778020 TGCGATACCCGTGATGGAGTTGG - Intergenic
1083308984 11:61775028-61775050 GGCCAGATGCATGATGAGGTTGG - Intronic
1084470741 11:69357606-69357628 TGCCACATCCATGGTGGGGTGGG + Intronic
1084966398 11:72746904-72746926 TGCCCTATGCATTATGGGTTGGG + Intronic
1090457778 11:126864839-126864861 TGGTATATGCATGATGGAGAGGG - Intronic
1090649292 11:128792266-128792288 GGGGAAATGCATGATGGGGGTGG - Intronic
1093109563 12:15133004-15133026 TGGGATATGAATAATGGGGGAGG - Intronic
1094462654 12:30714103-30714125 TGCTAAATGCAAGGTGGGGTTGG + Intronic
1095246698 12:39931514-39931536 TGCTATAGGAATGCTGGGGTCGG + Intronic
1100026399 12:90134021-90134043 TGGAACATGCATGATGGGCTTGG - Intergenic
1104033035 12:125078967-125078989 TGGGAAAGGGATGATGGGGTGGG + Intronic
1104475320 12:129066349-129066371 CGAGACATGCATGATGGGGAGGG + Intergenic
1104578260 12:129988436-129988458 TTCCATCTGGATGATGGGGTCGG - Intergenic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1118458437 14:65966137-65966159 TGGGATATACAGGACGGGGTAGG + Intronic
1122105986 14:99455286-99455308 TGCGATATGCATGATGGGGTGGG - Intronic
1122455294 14:101845607-101845629 TGAGAAAGGGATGATGGGGTTGG + Intronic
1123102480 14:105814386-105814408 TTCCATATGAATGATGGGGTAGG + Intergenic
1131371531 15:91885918-91885940 TGAAATATGCTTGATGTGGTCGG + Intronic
1139755858 16:69142994-69143016 TGCGGTAAGCATGATATGGTAGG - Intronic
1148151127 17:45396890-45396912 TGCGCAAGGCAGGATGGGGTGGG - Intronic
1153170286 18:2308453-2308475 TGCGAGATGAATGATGCCGTCGG - Intergenic
925066072 2:929566-929588 TGGGATATGCCTGATGGGCTTGG + Intergenic
926559821 2:14403742-14403764 TGTGATATGATTGATGGGATAGG + Intergenic
930373226 2:50531314-50531336 TGCCATATGCACGCTGGGATCGG + Exonic
933147241 2:78869138-78869160 TGGGATAAGCATGTTGGAGTTGG + Intergenic
937074527 2:119091268-119091290 TTGGATATGGATGAAGGGGTAGG + Intergenic
937260737 2:120585545-120585567 TGAGATATGCAGGCTGGGGGCGG + Intergenic
937291592 2:120785290-120785312 TGGGATCTTCATGATGAGGTAGG - Intronic
942500839 2:176589112-176589134 TGTGCTATGCATGTTGGGGTCGG + Intergenic
943200065 2:184811190-184811212 TGCTATATACCTGATGGGCTTGG - Intronic
943642687 2:190376395-190376417 TGGGATGTGCAGGATGGGGTGGG - Intergenic
944379446 2:199091301-199091323 TAAAATATCCATGATGGGGTGGG + Intergenic
945359534 2:208880208-208880230 TGCGGTCTTCATGATGGGATTGG + Intergenic
948269823 2:236665719-236665741 AGCGATATGAATGACGGGGTAGG + Intergenic
1169233808 20:3912341-3912363 TGGCATTTGCATGATTGGGTTGG + Intronic
1170402801 20:16005952-16005974 TGAGATATGCTTGATGAGATGGG - Intronic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1173191299 20:40878053-40878075 TGGGTGATCCATGATGGGGTAGG + Intergenic
1174934949 20:54857250-54857272 TGGGAAAGGCAGGATGGGGTAGG - Intergenic
1175769185 20:61612496-61612518 TGCCATATGCATGCTGTGGTTGG + Intronic
1182649158 22:31836742-31836764 TCCCATTTGCATGATGGGATTGG + Intronic
955587443 3:60496185-60496207 TTCCATATGTGTGATGGGGTCGG - Intronic
968570710 4:1338881-1338903 TTCGAAATGGATGAAGGGGTGGG + Intronic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
992066502 5:73114611-73114633 TGTGATGTGCATGGTGGTGTGGG - Intergenic
998366619 5:141636703-141636725 AGGGATATGCATGAGGGGTTGGG - Intronic
1001482488 5:172097990-172098012 TGGGAAAGGAATGATGGGGTGGG + Intronic
1004262397 6:14119223-14119245 TGAGTTATGCATGACGGGGATGG + Intronic
1015525617 6:134173248-134173270 TGAGATGTGCTTGATGGGGCTGG - Intronic
1015577663 6:134690161-134690183 TCAGAGATGCAGGATGGGGTTGG - Intergenic
1019039132 6:169088879-169088901 TGCGGTATCCATGGTGGGGTAGG + Intergenic
1019324002 7:429119-429141 TGAAAAATGCATGATGGCGTCGG - Intergenic
1023049616 7:36239714-36239736 TTCGGCATGCATGGTGGGGTGGG + Intronic
1031052387 7:116956856-116956878 TCCCATATGCAAGATGGGGCTGG + Intronic
1049220227 8:141425612-141425634 TGCGATATCCTTGGGGGGGTGGG + Intronic
1059555892 9:115279953-115279975 TGAGATATTCATGTTGGGGCTGG - Intronic
1061216810 9:129226327-129226349 GGGGATTTGCAAGATGGGGTTGG + Intergenic
1062027132 9:134345761-134345783 TGCAAAATGCATGACGGGGAAGG + Intronic
1196854974 X:119974163-119974185 ATACATATGCATGATGGGGTGGG - Intergenic