ID: 1122112630

View in Genome Browser
Species Human (GRCh38)
Location 14:99512990-99513012
Sequence TGGTGACCCCTGAGCCAACA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122112630_1122112632 4 Left 1122112630 14:99512990-99513012 CCGTGTTGGCTCAGGGGTCACCA 0: 1
1: 1
2: 2
3: 17
4: 172
Right 1122112632 14:99513017-99513039 TGTGCTGCCTCCGTAACAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 81
1122112630_1122112634 8 Left 1122112630 14:99512990-99513012 CCGTGTTGGCTCAGGGGTCACCA 0: 1
1: 1
2: 2
3: 17
4: 172
Right 1122112634 14:99513021-99513043 CTGCCTCCGTAACAGCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 151
1122112630_1122112633 7 Left 1122112630 14:99512990-99513012 CCGTGTTGGCTCAGGGGTCACCA 0: 1
1: 1
2: 2
3: 17
4: 172
Right 1122112633 14:99513020-99513042 GCTGCCTCCGTAACAGCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122112630 Original CRISPR TGGTGACCCCTGAGCCAACA CGG (reversed) Exonic
900093887 1:932571-932593 TGGTGGTCCCTGAACCCACACGG + Intronic
900485160 1:2919274-2919296 AGGTGACCCCGGAGACAGCAAGG - Intergenic
902659181 1:17889590-17889612 TGGTCACCCCTGAGACAGAAGGG + Intergenic
903130589 1:21277121-21277143 AGGTGACCCCTGAGCCACCTGGG - Intronic
903821025 1:26102697-26102719 TGGTGACCCCGAGGCCCACAAGG + Intergenic
904388306 1:30161986-30162008 TGGAGACCACTGATCCCACAGGG - Intergenic
904437585 1:30508623-30508645 AGGTGACACCAGAGCCACCAGGG - Intergenic
904925893 1:34048020-34048042 TGAAAACCCCTGAGCCAACTTGG + Intronic
905626848 1:39495085-39495107 TGGTGGCCCCAGAGCCACCATGG + Intronic
905641765 1:39594823-39594845 TGATGACCCCTAAGTCTACATGG - Intergenic
907878885 1:58524056-58524078 TGGTAACCCCTGAGCCTCTAAGG - Intronic
909040823 1:70649324-70649346 TGGTGACCCCTGTGCCACCACGG + Intergenic
909277575 1:73708217-73708239 TGGTGATCCCTTGGCCAAGAGGG - Intergenic
912505596 1:110153482-110153504 TGGAGTCCCCTGAGCCAGCATGG - Intronic
916342936 1:163756247-163756269 TATTTACCCCTGAGCCAAGATGG - Intergenic
916485426 1:165254303-165254325 TAGCGACTCCTGAGTCAACATGG - Intronic
918616510 1:186550608-186550630 TGGTGACACCCAAGCCAACAGGG - Intergenic
919022376 1:192123692-192123714 AGGTGACCCCTTAGGGAACAAGG + Intergenic
920187456 1:204169329-204169351 TGGGGTCCCCTTAGCCAAGAGGG - Intergenic
1062909560 10:1204004-1204026 CTGTGACCCCAGAACCAACACGG - Intronic
1063500055 10:6545423-6545445 TGGTGACACCTGCTACAACATGG + Intronic
1065337800 10:24672277-24672299 AGGTGACGCCTGTGCCAATAAGG - Intronic
1066659886 10:37728566-37728588 TCCTGACCCCTGAACCCACAGGG - Intergenic
1067559689 10:47296205-47296227 TGGTGCTCTCTGAGCAAACATGG - Intergenic
1073128064 10:101164644-101164666 TGGGGTCCCCTTGGCCAACAGGG + Intergenic
1078066426 11:8081783-8081805 TGGTGCTGCCTGACCCAACAAGG - Intronic
1078437001 11:11333696-11333718 AGGTGGCTCCTGAGCCACCACGG + Intronic
1079105848 11:17572022-17572044 TTGTGCCCCCTGAGTCCACAGGG + Intronic
1079349983 11:19684364-19684386 TGGTGACAACTGTGCCAGCAGGG - Intronic
1080031046 11:27661495-27661517 TGGTGAGGGCTGAGCCAAGATGG - Intronic
1080775422 11:35381660-35381682 TGGTGTCCTCTGAACCAGCAGGG - Intronic
1086112819 11:83217841-83217863 TGGTTCCCTCTGAGCCACCAGGG + Intronic
1086443221 11:86848838-86848860 TGGTTCCCTCTGAGCCACCAAGG - Intronic
1086923756 11:92617756-92617778 TGGTGACACCCGGGCAAACAAGG - Intronic
1087409066 11:97767458-97767480 TGGTAAATCCTCAGCCAACATGG - Intergenic
1088757512 11:112898275-112898297 TGGTGTCCCCTGGGCCAAGTCGG - Intergenic
1089040075 11:115439453-115439475 TGGTGATTCATGGGCCAACAAGG - Intronic
1089315332 11:117587436-117587458 TGGTGTCCCCAGACCCACCATGG - Intronic
1090843853 11:130514998-130515020 AGGTGACATCTGAGCCAACACGG + Intergenic
1095473436 12:42561171-42561193 TGGTGGAGACTGAGCCAACAAGG + Intronic
1095798502 12:46246870-46246892 TGGTGATACCTGGGCAAACAGGG + Intronic
1101834969 12:108288693-108288715 AGCTGACCCTTGAGCCAGCAAGG - Exonic
1102415813 12:112761681-112761703 AGGTCACCCCTGAGCCCACAAGG + Intronic
1102551044 12:113692389-113692411 TGGTGGCCCCGGCGGCAACAGGG - Intergenic
1103894180 12:124262214-124262236 TGGAGACACCTGAGCCAAGTAGG - Intronic
1103969642 12:124662023-124662045 TGGTGACCCTTGACCTAAGAAGG - Intergenic
1107637554 13:42407793-42407815 TGGTGACCCAAAAGCCAAAAAGG - Intergenic
1110699210 13:78526905-78526927 TGGTGACCCCCAGGCAAACAGGG + Intergenic
1112506179 13:99977422-99977444 GGGTGACCCCTGACCCATGAAGG - Intergenic
1115779940 14:36758131-36758153 TGGTGAGGTCTGAGCCACCAGGG - Intronic
1117323670 14:54648683-54648705 TGGTAGCCCCAGAGCCTACAAGG - Intronic
1119592359 14:75901667-75901689 ATGTGTCCCCTGAGCCAACCAGG - Intronic
1121248743 14:92483910-92483932 AGGTGGCCCCTGGGCCAGCATGG - Intronic
1121340923 14:93104660-93104682 TGGAGACCCCTCAGCCATCCTGG + Intronic
1122112630 14:99512990-99513012 TGGTGACCCCTGAGCCAACACGG - Exonic
1123944838 15:25233947-25233969 TGCTGAACACTGACCCAACATGG - Intergenic
1126426653 15:48534858-48534880 TGGTGGCCACTGTGCCAGCAAGG - Intronic
1128172499 15:65525369-65525391 TGGTGTCCCCTTGGCCAAGAAGG + Intergenic
1128538880 15:68511263-68511285 AGGTGACTCCTGAGACACCAGGG + Intergenic
1128604673 15:69027882-69027904 GGGTGGCCCCTTAACCAACATGG - Intronic
1129708779 15:77809621-77809643 TGGTGTCCCCTCAGCCCACCAGG - Intronic
1129952741 15:79606501-79606523 TGATGACCCATGGGCCAAAATGG + Intergenic
1130177550 15:81590815-81590837 TGGCCACCCCGCAGCCAACAGGG + Intergenic
1131453680 15:92566523-92566545 TGGGGTCCCCTTGGCCAACAGGG - Intergenic
1131693745 15:94854443-94854465 AGCTGACCACTGAGCCAACGGGG - Intergenic
1132211758 15:100029093-100029115 TGGTTCACCCTGAGCCACCAGGG + Intronic
1132839887 16:1973822-1973844 TGGTGATCCCTGAGGCAGTAGGG - Intronic
1137898403 16:52238361-52238383 TGCTGACCGTTGAGCCGACATGG + Intergenic
1138341225 16:56290286-56290308 TTGTGCCCCCTGACCCAACAAGG + Intronic
1139516216 16:67453849-67453871 TGGTAGGCCCTGAGCCAACAGGG - Intronic
1140416680 16:74778637-74778659 TGGGGACCCCTGAGGCATCTGGG - Intergenic
1145835458 17:27951240-27951262 TCGTGACCCCTGGGCCCAGATGG + Intergenic
1146061394 17:29609293-29609315 TGGTCACCCTTGAGCCAGCCCGG + Intronic
1146743256 17:35305122-35305144 TGGTTCCCTCTGAGCCACCAAGG - Intergenic
1151918694 17:77138153-77138175 TGGTGCCAGCTGAGCCATCAAGG + Intronic
1152166981 17:78715704-78715726 TGGTGTCCTCTGGGCCATCAGGG + Intronic
1152230817 17:79113165-79113187 TGGGGACACCTGAGCCAGCAGGG + Intronic
1156181574 18:34611672-34611694 TCCTGACTCCTGAGCCCACATGG - Intronic
1158373263 18:56832679-56832701 TGGTGATACCTGGGCAAACAGGG + Intronic
1159917294 18:74198656-74198678 TGCTCTCCCCTGAGCCACCAGGG - Intergenic
1160196210 18:76757900-76757922 TCGTGACCCTTCAGCCACCACGG - Intergenic
1160940561 19:1618687-1618709 TGGTGGCCCATGAGGCCACAAGG - Intronic
1161351193 19:3792881-3792903 TGGGGACACCTGAGCCGCCATGG + Intronic
1161948587 19:7454430-7454452 TGGTGGCCACTGATCCAAGAGGG - Intronic
1161948609 19:7454528-7454550 TGGTGCCCACTGATCCAAGAGGG - Intronic
1162018662 19:7858762-7858784 TGGGGAGCTCTGAGCCAGCAGGG + Intronic
1162960924 19:14126143-14126165 TGGTGGGCCCTGTGCCAGCAGGG - Exonic
1164602162 19:29569478-29569500 TGGTGAAACCTCAGCCAACTGGG + Intergenic
1165333325 19:35153649-35153671 TGGCGACCCCAGACCCAACCTGG - Intronic
1166667394 19:44689331-44689353 GGGTCAGCCCTGAGCCAGCAGGG + Intergenic
1167492254 19:49799568-49799590 TGGCCAACCCTGTGCCAACAGGG + Intronic
1168359943 19:55731095-55731117 TGGTGACCCCTCAGTGAACAGGG + Intronic
925346629 2:3176444-3176466 TGGGGACCCCTCAGCCTGCATGG - Intergenic
925725900 2:6870719-6870741 TGCTAAACCCTGGGCCAACAGGG - Intronic
925778802 2:7360496-7360518 TGCTGGCCCCAGAGCCATCAGGG - Intergenic
925873017 2:8286988-8287010 TGTTGACTCATGAGCCACCAAGG - Intergenic
926333713 2:11847763-11847785 TGGCCACCACTGAGCCACCAAGG - Intergenic
926737132 2:16082186-16082208 TGGGGACCCCAGAGGCAGCAAGG + Intergenic
933086623 2:78061352-78061374 TTGTTAGCCCTGAGCCAAAAAGG + Intergenic
933355719 2:81206845-81206867 TGGTGACACCCAAGCAAACAAGG + Intergenic
936066862 2:109339251-109339273 AGCTGACCCTTGAACCAACATGG - Intronic
936349812 2:111704059-111704081 AGGTGAGCCCTGAGCCATCTGGG - Intergenic
940146741 2:150553024-150553046 GAATGACCCCTGAACCAACATGG - Intergenic
940467081 2:154044763-154044785 AGGGGAACCCTGGGCCAACAAGG + Intronic
944991101 2:205236967-205236989 TGGTTACCTCTGAGCAAAGAGGG + Intronic
947225759 2:227838987-227839009 TGGTGATACCTTGGCCAACAGGG - Intergenic
948923916 2:241081928-241081950 GGCTGACCCCTGAGCCCCCAGGG + Intronic
1169000407 20:2164010-2164032 TGCTGCCCCCTGAGCCCAGACGG + Intronic
1170716660 20:18837578-18837600 TGGGGTCCCCTTAGCCAAGAGGG - Intergenic
1171021038 20:21584328-21584350 TGGTTAGCCGTGAGCAAACATGG + Intergenic
1171935171 20:31268331-31268353 TGGTGACACCTAGGCAAACAGGG - Intergenic
1173103390 20:40108510-40108532 TGGTGAAATCTGGGCCAACATGG + Intergenic
1173245082 20:41331215-41331237 TAGTGCACCCTGAGCCAGCATGG - Intergenic
1174221454 20:48958898-48958920 TGGTGAGGACTGAGGCAACAGGG + Intronic
1174505070 20:51012208-51012230 TGCTGACCCCTGAGCAAACGTGG - Intronic
1174516341 20:51095288-51095310 GGGTGACCCCAGAGCATACAAGG - Intergenic
1175653629 20:60750266-60750288 TGGTGACGGCTGAGCCAACATGG + Intergenic
1178836307 21:36100468-36100490 TGGTGCCCCCTGATCCATCAAGG + Intergenic
1180625320 22:17190243-17190265 AGGTGCCCCCAGAGCCAGCAAGG - Intronic
1183671061 22:39273166-39273188 TGGGGAGCCCAGATCCAACAGGG - Intergenic
1184197100 22:42937242-42937264 AGGTGACACCTGAGACAACATGG + Intronic
949095216 3:77534-77556 TAGTGACCCTTGAGCTATCAAGG - Intergenic
950396024 3:12734704-12734726 CTGCGACCCCTGAGCCCACAAGG - Exonic
951067969 3:18289812-18289834 TGGTGAAGCCTGAGCTAAAATGG - Intronic
951710776 3:25583400-25583422 TGGTGACCCTTGAGACAGCCTGG - Intronic
954122532 3:48507901-48507923 TGGAGCCCTCAGAGCCAACAAGG - Intergenic
954995995 3:54882187-54882209 TGATGTCCACAGAGCCAACATGG - Intronic
955339509 3:58114301-58114323 TGGTGAAACCTTGGCCAACATGG - Intronic
957445603 3:80310274-80310296 TGGTTCCCTCTGAGCCACCAAGG - Intergenic
957916456 3:86693706-86693728 TGGTTCCCTCTGAGCCACCAAGG + Intergenic
961110561 3:124279771-124279793 TGGTGCCCTCTGCTCCAACATGG - Intronic
964223393 3:154370381-154370403 TGGTTCCCTCTGAGCCACCAAGG - Intronic
966487139 3:180483878-180483900 TGGTGACACCCAAGCAAACAGGG + Intergenic
966626505 3:182022410-182022432 TGGTCACACCTGAGCCAATCTGG - Intergenic
967097183 3:186186752-186186774 TGAGGACCCGTGAGCCCACAGGG + Intronic
967527763 3:190514235-190514257 TGGTGACTTCTGAGCCCTCACGG - Intronic
969483341 4:7458422-7458444 TGGGGGCCCCTGAGCAAAGAAGG + Intronic
972420108 4:38879067-38879089 TGGTGGCCCAGGTGCCAACAGGG - Intronic
974040976 4:56857312-56857334 TTGTGATCCCACAGCCAACAAGG - Intergenic
989176406 5:38531516-38531538 TAGTGTCCTCTGAGCAAACATGG + Intronic
992635647 5:78723639-78723661 TGATGACCACCCAGCCAACAGGG + Intronic
997016006 5:129936507-129936529 TGGTGACCACTGAAGCAGCAAGG - Intronic
997367478 5:133335236-133335258 TGGAGACCTCTGAGCACACAGGG + Intronic
1000787221 5:165560017-165560039 TGCTGAGTCCTGAGGCAACATGG - Intergenic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1004497899 6:16181657-16181679 TGGCCACCCCCCAGCCAACAGGG - Intergenic
1005094470 6:22099229-22099251 TGATGACCTTTGATCCAACATGG - Intergenic
1007140007 6:39562580-39562602 TTGTGACCCCTGAGCCATAAAGG - Intronic
1008394119 6:50987094-50987116 TTATGACCCCTGAGCAATCAGGG + Intergenic
1014070470 6:117175713-117175735 TGGTGATACCTGGGCAAACAGGG + Intergenic
1016933016 6:149427957-149427979 TGGTGACCCTAGAGGCAACATGG - Intergenic
1017093690 6:150784633-150784655 TGGTGACCTCTGCTCCAACCTGG - Intronic
1019225825 6:170507138-170507160 TGGCGCCCCCTTGGCCAACAAGG + Intergenic
1020124473 7:5525831-5525853 TGGTGAGCCCTGGGCCACCTTGG - Intergenic
1023866517 7:44241005-44241027 TGGTGACCCCTGAGGCTTGAGGG - Intronic
1026930661 7:74221451-74221473 CTGGGACCCCTGAGCCACCAGGG - Intronic
1027566019 7:79795628-79795650 TGGGGACCCCTTGGCCAAGATGG + Intergenic
1028430111 7:90736595-90736617 TGGTGACCCTTAAGGAAACAGGG - Intronic
1030376110 7:108755356-108755378 AGGTGACCCCTCAGCCACCACGG + Intergenic
1031890324 7:127286835-127286857 TAGTGACCTCTGTGCCAAGATGG - Intergenic
1033256653 7:139807158-139807180 TGATGACCTCTGAGACCACATGG - Intronic
1034239097 7:149596101-149596123 TTGTAACCCCTGAGCCCCCAAGG + Intergenic
1035400706 7:158563635-158563657 GGGTGTGCCCTGAGCTAACAAGG - Intronic
1037341498 8:17850238-17850260 TGCTGATCTCTGAGTCAACATGG + Intergenic
1038218104 8:25581555-25581577 TGGTGATGCCTCAGTCAACAAGG + Intergenic
1044508545 8:93049115-93049137 TGGTTACCTCAGAGCCAGCAGGG + Intergenic
1047949144 8:129914289-129914311 TGGTGACACCGCTGCCAACAGGG + Intronic
1049434446 8:142579955-142579977 AGGTGGCCCCTGAGCCCAGATGG + Intergenic
1049482435 8:142833087-142833109 TGGTTCCCCGTGAGCCAAGACGG - Intergenic
1049483277 8:142837934-142837956 TGGTTCCCCGTGAGCCAAGACGG + Intronic
1051074394 9:13213278-13213300 TGTGGACCCCTGGGTCAACAGGG - Intronic
1053608067 9:39680688-39680710 TGGTGATACCTGGGCAAACAGGG - Intergenic
1053865910 9:42437048-42437070 TGGTGATACCTGGGCAAACAGGG - Intergenic
1054245465 9:62661721-62661743 TGGTGATACCTGGGCAAACAGGG + Intergenic
1054559593 9:66696252-66696274 TGGTGATACCTGGGCAAACAGGG + Intergenic
1055210405 9:73783850-73783872 TGGTGATACCCAAGCCAACAGGG + Intergenic
1055290571 9:74778449-74778471 TGGTGCCCCCTGAGCCAACATGG - Intronic
1057610601 9:96539874-96539896 TGCTGATCCCTGAGCCAAACAGG + Intronic
1058483948 9:105424375-105424397 TGTGGACACCTGAGCCCACAAGG - Intronic
1058819130 9:108712860-108712882 TGGTGACACCCAGGCCAACAGGG + Intergenic
1059307504 9:113366419-113366441 TGGAAACACCAGAGCCAACAAGG - Intronic
1060441845 9:123647247-123647269 TGCTGGCCCCTGAGCCAAGGTGG - Intronic
1061966757 9:134019006-134019028 TGGGGTCCCCTTAGCCAAGAAGG + Intergenic
1062052194 9:134453378-134453400 TGGTGGCCCTTGAGACCACATGG + Intergenic
1189225581 X:39410588-39410610 GGATGACCCCTGACCCAAGATGG + Intergenic
1193249384 X:79270616-79270638 TTCTGACCCCTCACCCAACAGGG + Intergenic
1193818694 X:86135294-86135316 AGGTGACACTTGAGCCATCAAGG - Intergenic
1195127342 X:101821831-101821853 TGGTGACACCAAGGCCAACAGGG - Intergenic
1199153146 X:144513828-144513850 TGGTGCCCCCTTAGCCAAGAGGG - Intergenic
1199589819 X:149456952-149456974 TGCTGACTCCTAACCCAACAGGG + Intergenic
1200246702 X:154530365-154530387 TGGTGAGACCTGTGGCAACAGGG - Intergenic
1200810421 Y:7479111-7479133 TGGTGACGCCCAAGCAAACAGGG - Intergenic
1201948458 Y:19537273-19537295 TGGAGACCTCATAGCCAACATGG - Intergenic