ID: 1122112675

View in Genome Browser
Species Human (GRCh38)
Location 14:99513247-99513269
Sequence GACTTGGCTGCCACTCAAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122112670_1122112675 4 Left 1122112670 14:99513220-99513242 CCCAAACATGATGCACACGGGCT 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1122112666_1122112675 13 Left 1122112666 14:99513211-99513233 CCAACCTGACCCAAACATGATGC 0: 1
1: 1
2: 2
3: 16
4: 102
Right 1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1122112665_1122112675 18 Left 1122112665 14:99513206-99513228 CCACGCCAACCTGACCCAAACAT 0: 1
1: 0
2: 2
3: 5
4: 91
Right 1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1122112667_1122112675 9 Left 1122112667 14:99513215-99513237 CCTGACCCAAACATGATGCACAC 0: 2
1: 0
2: 0
3: 8
4: 125
Right 1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1122112671_1122112675 3 Left 1122112671 14:99513221-99513243 CCAAACATGATGCACACGGGCTC 0: 2
1: 0
2: 0
3: 4
4: 44
Right 1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG 0: 1
1: 0
2: 1
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122112675 Original CRISPR GACTTGGCTGCCACTCAAAA TGG Exonic
905951782 1:41958126-41958148 GCCCTGGGTGCCACTCAAAATGG - Intronic
906872284 1:49496210-49496232 TACTTGGCAGCCATTTAAAATGG + Intronic
907595190 1:55713160-55713182 CACTGGGTTACCACTCAAAAAGG - Intergenic
907730569 1:57061621-57061643 GACTTGGCTGACACAGAACAAGG + Intronic
912911371 1:113762146-113762168 GTCTTAGCTGCCAATCAAAATGG + Exonic
920200541 1:204257418-204257440 GAGGTGGCAGCCGCTCAAAACGG + Exonic
920526416 1:206670087-206670109 GACTTGGCTTCAACCAAAAAAGG - Intronic
922554666 1:226523710-226523732 GACAAGGCTCCCACCCAAAAGGG + Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1069846158 10:71373140-71373162 GTCTTTGCTGAGACTCAAAAAGG + Intergenic
1071164915 10:82794640-82794662 GGCTTGGCTGCAGCTCAAACAGG + Intronic
1071489538 10:86126949-86126971 GACCTGGCTGTCACGCCAAAGGG + Intronic
1079733386 11:23963512-23963534 GTCTGAGCTGCCACTCAAATTGG + Intergenic
1080908846 11:36574858-36574880 GAGGTGGCTGCCACTCAAAGTGG - Exonic
1083401726 11:62428009-62428031 GGGGTGTCTGCCACTCAAAATGG + Intergenic
1085419627 11:76344446-76344468 GACTAGGCTGCTCCTCAAAGAGG - Intergenic
1085448108 11:76614765-76614787 GCCCTGGCTGCCAGTCAAAGGGG + Intergenic
1085834835 11:79942038-79942060 GTCTCTGCTGCCACTCAACATGG + Intergenic
1086953072 11:92910342-92910364 GTCTTGGCTGCCAGTTCAAAGGG - Intergenic
1089619483 11:119714162-119714184 GCCCTGGCTGCCCCTCAATAGGG - Intronic
1090027966 11:123183846-123183868 GGTGTGGCTGCCACTCATAATGG + Intronic
1093577482 12:20750377-20750399 GACTGGGCTTCCACTGATAAAGG + Intronic
1096466580 12:51850052-51850074 GGCTAGGCAGCCACTCAAAAGGG - Intergenic
1100779513 12:98009146-98009168 GAGGTGGCTGCCCCTCAACAGGG + Intergenic
1102424416 12:112829879-112829901 GACTTGCTTCCCACTTAAAAAGG + Intronic
1104620732 12:130310798-130310820 GACTTCTCTGCCATTCCAAAAGG - Intergenic
1116418116 14:44702809-44702831 AACTTGGCTGCAAATCCAAATGG - Intergenic
1119924897 14:78484336-78484358 GTCCTGCCTGCCTCTCAAAAGGG - Intronic
1120620819 14:86762022-86762044 GACCTGTGTGCCACTCATAAAGG - Intergenic
1121215548 14:92244872-92244894 GCTTGGGCTGCCACTCCAAAGGG - Intergenic
1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG + Exonic
1124855546 15:33384090-33384112 GACTTGCCTGCCTATCAAAGGGG - Intronic
1129322967 15:74784753-74784775 GACATGGCTGCCCCCCAAAGGGG + Intronic
1136143122 16:28299794-28299816 GACCTGGCTTCCACTCCAAGTGG - Intronic
1138276374 16:55737836-55737858 CACTTGGCTGCCACCCAACCAGG + Intergenic
1153228235 18:2913611-2913633 GACTTTTCTGCCACTCTAACTGG + Exonic
1157921974 18:51722379-51722401 GATTTTGCTGCCACTCAAGCTGG + Intergenic
1159568765 18:70087905-70087927 TACTTGACTGCCGCTCAACATGG - Intronic
1160386368 18:78499390-78499412 GAATTAGCTGACACTCAAAGAGG + Intergenic
1164723284 19:30447651-30447673 CACTTGGCTGCCTCTCAAGTAGG - Intronic
1164852685 19:31497891-31497913 TGCTTGGCTGCCACTCAGCATGG - Intergenic
1165485122 19:36090747-36090769 TACCCTGCTGCCACTCAAAATGG - Intronic
931804851 2:65794292-65794314 GACTTGGATGCTAATCAAGATGG + Intergenic
932810527 2:74822020-74822042 GAGAAGGCTGTCACTCAAAATGG - Intergenic
939397568 2:141650526-141650548 ACCATGGCTGCCACTCAAAATGG + Intronic
939637365 2:144598716-144598738 GACATGGCTGCCCCCTAAAAAGG - Intergenic
941328796 2:164150349-164150371 CAATTGGGAGCCACTCAAAATGG + Intergenic
942378512 2:175361954-175361976 GACTTTGCTCCCACACAGAATGG - Intergenic
944427233 2:199595888-199595910 CACTTCGCTGCCACTCCTAAAGG - Intergenic
944656870 2:201884216-201884238 GACTTGGCTAGCAAGCAAAATGG - Intronic
1172639870 20:36434448-36434470 GACCGGGCTTCCTCTCAAAATGG + Intronic
1173672210 20:44806433-44806455 GACTCGCCTGCCAGTCAAGAGGG - Intronic
1174897883 20:54470061-54470083 GACTTGGCTATCACTAACAAGGG - Intergenic
1177627395 21:23680644-23680666 GATTTGGTTGCCACTCAAGCCGG + Intergenic
1178478381 21:32957371-32957393 CACTTGCCTGCTACTCACAAAGG - Intergenic
1181096222 22:20507025-20507047 GACGTGGCTGCTGGTCAAAAGGG + Intronic
1183560001 22:38564960-38564982 GCCTTGGCTGCCTCTGAAGAAGG + Intronic
950208382 3:11097345-11097367 GACATTGCTGCCACTCCAGAGGG + Intergenic
951152876 3:19313185-19313207 GACAAGGCAGGCACTCAAAAGGG + Intronic
954003660 3:47576959-47576981 GACTTGGCCTCCAGTGAAAATGG - Exonic
954024101 3:47768304-47768326 TACTTGCCTTCCTCTCAAAATGG - Intronic
958166085 3:89879265-89879287 AAATTGGCTGTAACTCAAAATGG - Intergenic
964194316 3:154045146-154045168 GTCTTGGCAGCCCCTGAAAAGGG - Intergenic
964910234 3:161772165-161772187 GACTGGGCTTCCTCACAAAATGG - Intergenic
971428317 4:26537696-26537718 AACTTGGCTCCCACCCTAAAAGG + Intergenic
982425079 4:155248602-155248624 GACTTCTCTGCCACTCAGAAAGG + Intergenic
984201063 4:176721786-176721808 GACTTGGCTGTCCCTCAGACAGG - Intronic
986842669 5:11716141-11716163 GGCTTGACAGCCACTCATAAGGG + Intronic
987020517 5:13865595-13865617 AACTTGGCTGCCTATCAAAGAGG + Intronic
987609095 5:20178947-20178969 GAGTTGACAGTCACTCAAAAGGG + Intronic
987968999 5:24917647-24917669 GACTTGGCTGTGATTCAAGATGG + Intergenic
994488202 5:100406419-100406441 GACTTGACTGATACTCCAAATGG + Intergenic
995369088 5:111398410-111398432 AACTAGGCTGCCACACCAAAAGG + Intronic
997581629 5:135020815-135020837 AACTTGGCTTTCACGCAAAATGG - Intergenic
999317601 5:150594300-150594322 GGCTTGGCTGCTACACAAAGGGG + Intergenic
1003157573 6:3609379-3609401 GGCTTGACCCCCACTCAAAAAGG - Intergenic
1003977777 6:11360155-11360177 GTCTTGGGTGCCACTCAAAAGGG + Intronic
1004872656 6:19922868-19922890 TCCTTGGCTGCCACTAATAAAGG + Intergenic
1008023285 6:46604385-46604407 CTCTTGGCTGCCAAACAAAAGGG + Intronic
1009642237 6:66352871-66352893 GACTTGGCTTCTAATCAAAGAGG - Intergenic
1011059254 6:83245001-83245023 GACATGCATGCCACTAAAAACGG - Intronic
1014618050 6:123628654-123628676 GACATGGCTGCAATTCAAATTGG + Intronic
1015755082 6:136598662-136598684 CACTTGGCTTCCCCTCAAGAGGG - Intronic
1017277754 6:152589678-152589700 GCCTTTGCTGCCTCTCTAAAGGG - Intronic
1017622930 6:156317618-156317640 GCCTGGGCTGCCTCTCAGAAGGG - Intergenic
1017744851 6:157437003-157437025 GACTTAGCAGCCACTGAAAAGGG + Intronic
1019706571 7:2499819-2499841 GGCTTGGCTACCACTAAACAGGG - Intergenic
1020222233 7:6248487-6248509 GACCTGGCTTCCACTCCAGATGG + Intronic
1024192429 7:47026487-47026509 AACTTGGATGCCAATCAAAAGGG - Intergenic
1024666269 7:51550261-51550283 AACTTGGCTGTGACTCAGAATGG - Intergenic
1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG + Intergenic
1032912210 7:136446248-136446270 GATTTGGCTGTCTCTCAAAGAGG - Intergenic
1034560021 7:151873866-151873888 CATGTGGCTGCCACACAAAATGG + Intronic
1035241285 7:157531302-157531324 GACATGGCTCACACTCAAGAAGG + Intergenic
1035361377 7:158315981-158316003 GCCTGGGCTCCCACTCAACAAGG + Intronic
1037757529 8:21720931-21720953 GAAATGCCTGACACTCAAAAGGG + Intronic
1043684015 8:83065836-83065858 GACTTGGCTCACACTCAGACTGG - Intergenic
1045233583 8:100329338-100329360 GACTTGGCAGCCATTCATGAGGG + Intronic
1046361255 8:113159918-113159940 GACTTGGCTGCCAGCCAGAGTGG - Intronic
1047830755 8:128627398-128627420 GACTTTGCTGTCACTGAAACTGG - Intergenic
1048810354 8:138280254-138280276 GCCTTGGCTGACACTCAATCAGG - Intronic
1049957777 9:709389-709411 GACTGGGCTGCCTTTCTAAATGG - Intronic
1050665472 9:7931290-7931312 AACTTTGCTGGCACTCAAAGCGG + Intergenic
1051882543 9:21854659-21854681 GACTCCGGTGCCACTCAAAGGGG + Exonic
1057742176 9:97721463-97721485 GACTTGGGTGCCACTCACAGTGG + Intergenic
1187274766 X:17807553-17807575 GAGTAAGCTGCAACTCAAAAAGG + Intronic
1187705555 X:22006204-22006226 GAAATGGCTGACAGTCAAAATGG - Intergenic
1189575521 X:42348976-42348998 TTCTTTGCTGGCACTCAAAATGG + Intergenic
1201481933 Y:14449091-14449113 AACTTGTCTACCACTCACAAAGG + Intergenic