ID: 1122114886

View in Genome Browser
Species Human (GRCh38)
Location 14:99522689-99522711
Sequence CCACGGGTTCGGGGCTCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122114873_1122114886 6 Left 1122114873 14:99522660-99522682 CCACATCCACAGGCGAGGCCTCC 0: 1
1: 0
2: 0
3: 10
4: 189
Right 1122114886 14:99522689-99522711 CCACGGGTTCGGGGCTCTCTCGG 0: 1
1: 0
2: 1
3: 7
4: 70
1122114870_1122114886 25 Left 1122114870 14:99522641-99522663 CCATCGGCAGCAGATGGGGCCAC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1122114886 14:99522689-99522711 CCACGGGTTCGGGGCTCTCTCGG 0: 1
1: 0
2: 1
3: 7
4: 70
1122114874_1122114886 0 Left 1122114874 14:99522666-99522688 CCACAGGCGAGGCCTCCCACCTC 0: 1
1: 0
2: 2
3: 44
4: 342
Right 1122114886 14:99522689-99522711 CCACGGGTTCGGGGCTCTCTCGG 0: 1
1: 0
2: 1
3: 7
4: 70
1122114868_1122114886 29 Left 1122114868 14:99522637-99522659 CCAGCCATCGGCAGCAGATGGGG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1122114886 14:99522689-99522711 CCACGGGTTCGGGGCTCTCTCGG 0: 1
1: 0
2: 1
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122114886 Original CRISPR CCACGGGTTCGGGGCTCTCT CGG Intronic