ID: 1122116605

View in Genome Browser
Species Human (GRCh38)
Location 14:99530695-99530717
Sequence AGCACCCCAGGCGGTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122116605_1122116614 5 Left 1122116605 14:99530695-99530717 CCCTTGGGACCGCCTGGGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1122116614 14:99530723-99530745 GGGGCCACATCACACTGCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 87
1122116605_1122116618 25 Left 1122116605 14:99530695-99530717 CCCTTGGGACCGCCTGGGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1122116618 14:99530743-99530765 TGGGCATCACCTCCCAGGTGAGG 0: 1
1: 0
2: 1
3: 27
4: 440
1122116605_1122116617 20 Left 1122116605 14:99530695-99530717 CCCTTGGGACCGCCTGGGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1122116617 14:99530738-99530760 TGCGCTGGGCATCACCTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1122116605_1122116615 6 Left 1122116605 14:99530695-99530717 CCCTTGGGACCGCCTGGGGTGCT 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1122116615 14:99530724-99530746 GGGCCACATCACACTGCGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122116605 Original CRISPR AGCACCCCAGGCGGTCCCAA GGG (reversed) Intronic