ID: 1122119350

View in Genome Browser
Species Human (GRCh38)
Location 14:99543650-99543672
Sequence CAGCCTGAGCAAAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1228
Summary {0: 1, 1: 7, 2: 43, 3: 216, 4: 961}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122119350 Original CRISPR CAGCCTGAGCAAAGGCAGGG AGG Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900495151 1:2972817-2972839 CAGTCAGAGGAAAGTCAGGGCGG + Intergenic
900512667 1:3067993-3068015 CGGGCTGAGCGCAGGCAGGGTGG - Intergenic
900616111 1:3566410-3566432 CAGCCAGCGCTAAGGCAGGGTGG + Intronic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901752135 1:11416826-11416848 CAGCATGGGCAAAGGCTTGGAGG - Intergenic
901858670 1:12060244-12060266 CAGCGTGGGCAAAGGCTGGCAGG + Intergenic
901882476 1:12202323-12202345 CAGCATGGGCAAAGGCGGGAGGG - Intronic
902156643 1:14492972-14492994 CAGCCAGGGCAAAGGCACTGAGG - Intergenic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902367816 1:15989125-15989147 AAGCCTGAACAGTGGCAGGGAGG - Intergenic
902449636 1:16488701-16488723 AGGCATGAGCAAAGGCATGGAGG - Intergenic
902504846 1:16932641-16932663 AGGCATGAGCAAAGGCATGGAGG + Intronic
902651119 1:17838280-17838302 CAACCTTACCAAAGCCAGGGTGG + Intergenic
902794567 1:18792860-18792882 CGGCATGTGCAAAGGCATGGAGG + Intergenic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902957212 1:19933916-19933938 CAGCCTGTGCAAAGGCCCTGTGG + Intergenic
902965170 1:19995849-19995871 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903281934 1:22255039-22255061 CACGGTGAGCAAAGGCAGGGAGG + Intergenic
903320543 1:22540596-22540618 CAGCCAGTGCAAAGGCCTGGAGG + Intergenic
903328499 1:22585155-22585177 CAGCCTGTGCAAAGGCCCCGAGG + Intronic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903359635 1:22768796-22768818 CAGCTTGTACAAAGGCCGGGAGG - Intronic
903373844 1:22853652-22853674 CTGCCTGAGCAAAGGCCCAGAGG + Intronic
903438879 1:23372190-23372212 CAGCATGTGCGAAGGCACGGAGG + Intergenic
903537632 1:24077450-24077472 CAGCAAGGGCAAAGGCAGGGAGG - Intronic
903565033 1:24258828-24258850 CAGGCAGAGGACAGGCAGGGAGG - Intergenic
903659078 1:24965917-24965939 CAGCATGAGCGAAGGCCCGGAGG - Intergenic
903818795 1:26085045-26085067 CAGCATGTGCAAAGGCCAGGAGG - Intergenic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904263855 1:29306664-29306686 CTGCCTAAGCAAAGGCCTGGGGG + Intronic
904355922 1:29939820-29939842 CAGCATAAGCAAAGGCCTGGAGG - Intergenic
904460634 1:30677661-30677683 CAGCATGTGCAAAGGCTGGGAGG + Intergenic
904490897 1:30858433-30858455 CAGCATGGGCAAAGGTAGAGAGG - Intergenic
904583386 1:31564522-31564544 CAGCAAGAGCAAAGACAAGGAGG - Intergenic
904616197 1:31751184-31751206 CAGCCTGTGCAAGGGCGTGGAGG - Intronic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904787731 1:32995310-32995332 CAGCTTGTACAAAGGCATGGAGG - Intergenic
904814186 1:33182739-33182761 CAGCCTGTGCAAAAGCATAGAGG + Intergenic
905227245 1:36487251-36487273 CAGCCTGAGCAAAGGCCAGGAGG - Intergenic
905322928 1:37130498-37130520 CTGCGTGTGCAAAGGCTGGGAGG - Intergenic
905328795 1:37177382-37177404 CAGCCTGAGCAAAGGCCCAGAGG + Intergenic
905335123 1:37239761-37239783 CAGCATGAGTAAAGGCCTGGAGG - Intergenic
905490054 1:38336347-38336369 CAGCCAAATCAATGGCAGGGAGG - Intergenic
905510200 1:38513317-38513339 CCGCCTGTGCAAAGGCTTGGAGG - Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905794076 1:40805616-40805638 CAGCATGAGTAAAGGTGGGGAGG + Intronic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
905973374 1:42157321-42157343 CAGCCTGAATAAAGGCACTGAGG - Intergenic
906069818 1:43008274-43008296 CAGCCTAGGAAAAGGCTGGGAGG - Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906287092 1:44594612-44594634 CAGCCTGAGCCAGGGCGGTGGGG - Intronic
906399821 1:45496676-45496698 CAGGCTGGTCACAGGCAGGGAGG - Intronic
906479828 1:46192769-46192791 AAGCCTGGGCAAAGGTAGGATGG - Intronic
906718192 1:47985937-47985959 CAACATGAGCAAATGCATGGAGG + Intronic
906815034 1:48870003-48870025 TAGCATAAGCAAAGGCATGGAGG - Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907048365 1:51313667-51313689 CAGGCTGGGCAAAGGCCTGGAGG - Intronic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907238770 1:53069281-53069303 CAGCATGTGCAAAGGCCTGGAGG + Intronic
907266843 1:53267042-53267064 CAACCTGAGCAAAGGCTCTGAGG - Intronic
907310262 1:53535016-53535038 AAGCATGAACAAAAGCAGGGAGG + Intronic
907388404 1:54140520-54140542 CAGCATGTGCAAAGGCCTGGAGG - Intronic
907441573 1:54481754-54481776 CAGGCTGGGCAGAGACAGGGTGG + Intergenic
907516412 1:54996088-54996110 CAGCATGTGCAAAGGCACTGAGG - Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907718472 1:56950029-56950051 CAGCTTAAGCAAAAGCATGGAGG + Intronic
907811295 1:57872884-57872906 AAGGCTGAGCCAAAGCAGGGTGG + Intronic
907831336 1:58066991-58067013 CAGCATGAGCAAAGGCTCTGAGG - Intronic
907927069 1:58964984-58965006 CAGCCTGTGCAAAGTCCCGGGGG + Intergenic
907973426 1:59407360-59407382 CCGCCTGAGAAAAGGGAGGAGGG + Intronic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
910046329 1:82921599-82921621 CATCTGGAGCAAAGTCAGGGTGG + Intergenic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
910342590 1:86204566-86204588 CAGCTTGTACAAAGGCATGGAGG + Intergenic
911044291 1:93615900-93615922 AGGCCTGAGAAAAGGGAGGGGGG + Intronic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
912393603 1:109322223-109322245 CAGCCTGAGGCCAGGCACGGTGG - Intronic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912720561 1:112016442-112016464 CAACTTGAGGAAAGGCAAGGAGG - Intergenic
912806063 1:112758105-112758127 CAGCCTGAGGGAGGGCAGGGTGG - Intergenic
912976492 1:114335692-114335714 TAGCATGAGCAAAGGCATGAAGG + Intergenic
913277421 1:117152663-117152685 CAGCCTTCTCAAAGGCAGGGTGG + Intronic
913360633 1:117976527-117976549 CAGGCTGAGCAGAGGCTGTGAGG + Intronic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
915322037 1:155061509-155061531 CGCCCTGAGCCAAGGCAGGTGGG + Intronic
916488653 1:165281584-165281606 CAGGCTGACCACAGGCAGAGAGG + Intronic
917311775 1:173686115-173686137 CAGCCTGAGGAGAGTCAGGAGGG + Intergenic
917790283 1:178494960-178494982 CAGCTTGTGCCAAGGCTGGGAGG - Intergenic
917843739 1:179003265-179003287 CAGCCTAAGCAGGGGCAGGCAGG + Intergenic
918010656 1:180583526-180583548 CAGCATGTGCAAAGTCATGGAGG - Intergenic
918115599 1:181494006-181494028 CAGCAAGTGCAAAGGCACGGAGG - Intronic
918299146 1:183186348-183186370 CAGCCAGAGCGCAGGCATGGCGG - Exonic
918322263 1:183375445-183375467 CAGCCTGGGCAAAGGCATAGGGG - Intronic
918475240 1:184917570-184917592 AAGTCTGAGTAAAGGGAGGGTGG - Intronic
919406924 1:197196813-197196835 CAGCATGTGCAAAGGCATTGAGG - Intronic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
919925234 1:202188685-202188707 CAGCCTGGGCCCAGGGAGGGAGG - Intergenic
920092946 1:203467073-203467095 CAGACTGGGCAAAGGCATAGAGG + Intergenic
920192226 1:204201084-204201106 GGGCCTGGGAAAAGGCAGGGTGG - Intronic
920306825 1:205023849-205023871 CACCCCGAGGAAAGGGAGGGGGG - Intergenic
920558318 1:206920510-206920532 CAGCATGGGCAAAGACATGGTGG + Intronic
920838706 1:209535757-209535779 CAGCCTGGGGAAAGACGGGGAGG + Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921412615 1:214851768-214851790 CAGCGTGATGAAAGGCAGGAAGG - Intergenic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922696092 1:227731805-227731827 CAGGCCCTGCAAAGGCAGGGAGG + Exonic
923087764 1:230714179-230714201 CAGCCTGTGCACAGGCAGCCTGG - Exonic
923164681 1:231348635-231348657 ACACCTGAGGAAAGGCAGGGAGG - Intronic
923512224 1:234662357-234662379 CAGCCTGGGGAGTGGCAGGGAGG + Intergenic
924371338 1:243353582-243353604 CAGCTTGAGCAAAGGAATGGGGG + Intronic
924655193 1:245968351-245968373 CAGCCTAGGCAAAGGCACTGAGG - Intronic
1062783441 10:238860-238882 CTGCATGAGTAAAGGCAGTGGGG - Intronic
1064730714 10:18327924-18327946 ATGCCTGAGGAAAGGCAGAGTGG + Intronic
1065487267 10:26247533-26247555 AAGCCTTAGCAGAGGCATGGGGG + Intronic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067154092 10:43760473-43760495 CAGCCTGAGCTCAGGGAGTGGGG - Intergenic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1067663296 10:48252468-48252490 CAGCCAGAGCTCAAGCAGGGCGG + Intronic
1067705738 10:48605219-48605241 CAGCCTCAGCAAAGGATGGCCGG - Intronic
1067794322 10:49309739-49309761 CAGGCTGTGCATAGACAGGGAGG + Intronic
1067822341 10:49540966-49540988 CAGCCTGAGCTAAGGCAGCTGGG - Intergenic
1068275691 10:54792853-54792875 CAGGTTGAGCACTGGCAGGGTGG + Intronic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1069416450 10:68204942-68204964 CAGCCTGCACAAAGGCGTGGTGG - Intronic
1069563792 10:69450168-69450190 CAGGCTGAGAAAAGGCCAGGTGG + Intergenic
1069637083 10:69931385-69931407 CAGCCTGGGAGCAGGCAGGGAGG + Intronic
1069736251 10:70656630-70656652 CAGCCTGTGCAAAGGCCTGGGGG + Intergenic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070310942 10:75273354-75273376 CAGCTTGAGCAAAGGCCAGGAGG - Intergenic
1070661093 10:78305782-78305804 CAGCTTGGGCAAAGGCATGGAGG - Intergenic
1070753676 10:78978363-78978385 CAGCGTGAACAAAACCAGGGAGG - Intergenic
1070772705 10:79091686-79091708 CGGCATGACCAAAGGAAGGGAGG + Intronic
1070780208 10:79133180-79133202 CTGCATGTGAAAAGGCAGGGAGG - Intronic
1070808594 10:79285903-79285925 CAGCCTGAGAAGAGGCACAGAGG + Intronic
1070836718 10:79452021-79452043 CAGCAAGTGCAAAGGCATGGAGG - Intergenic
1070858652 10:79630148-79630170 CAGCCTGGACAAAGGCTGGAAGG + Intergenic
1071300875 10:84255249-84255271 CGATCTGAGCAAAGGGAGGGTGG - Intronic
1071497140 10:86176432-86176454 CAGCATGTGCAAAGGCACTGAGG + Intronic
1071508992 10:86249650-86249672 CTGCCTGGGCAAAGGCATAGAGG - Intronic
1071709894 10:88039715-88039737 CAACTTGAGCAAATGCAGGAGGG + Intergenic
1071807365 10:89138447-89138469 CAGCCTGAGCACAAGCACAGAGG + Intergenic
1072287247 10:93927842-93927864 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1072343250 10:94476808-94476830 TAACATGAGCAAAGGCATGGAGG - Intronic
1073353280 10:102834808-102834830 CAACCTGAGCAAAGACAGCCTGG - Exonic
1073817324 10:107222401-107222423 CAGCATGATTAAAGGCAGAGAGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074425654 10:113348974-113348996 GATCCTGTGCAAAGGCACGGAGG + Intergenic
1074448459 10:113539504-113539526 CAACATGAGCAAAGGCTTGGAGG - Intergenic
1074608778 10:115001242-115001264 CTGCCTGAGCAAGTGCAAGGAGG - Intergenic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074689199 10:115989061-115989083 CAGCCTGGGAAAAGGAAGTGGGG + Intergenic
1075122326 10:119673087-119673109 CAGCATGGGCAAAGGCACAGGGG - Intronic
1075200761 10:120402016-120402038 CAGCATGTGCAAAGGCACTGGGG - Intergenic
1075549544 10:123382080-123382102 CAGCCTATGCAAAGGCACTGAGG - Intergenic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076509108 10:130999610-130999632 CAGCCTGAGCCACTGCAGGCAGG + Intergenic
1076886654 10:133266183-133266205 CAAGCTGAGGAAAGGCAGAGGGG + Intronic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077180339 11:1209443-1209465 GAGCCTGAGGAAGGGCATGGAGG - Intergenic
1077395893 11:2321048-2321070 GAGCCTGAGCCAAGCCATGGTGG - Intergenic
1077634376 11:3832068-3832090 CAAGCAGAGCAAAGGCAGTGTGG + Intronic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078085932 11:8233048-8233070 CAGCCTGGGCACGGGCAGTGGGG - Intronic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078532682 11:12149155-12149177 CAGCATCAGCAAAGGCATGTGGG + Intronic
1078545572 11:12244730-12244752 TAGCCTGTGCAAAGGCAGGCAGG + Intronic
1078581726 11:12544142-12544164 CAGACTGAGGCCAGGCAGGGAGG + Intergenic
1078657155 11:13252349-13252371 TAGCTTGAGCAAAAGCATGGAGG + Intergenic
1078662701 11:13299844-13299866 AATGCTGAGCAAAGGCAGGAGGG - Intronic
1078850687 11:15160309-15160331 CAGCATGTGCAAAGCCTGGGAGG + Intronic
1078966592 11:16351647-16351669 CAGGCAGAGCAAAGGCTAGGAGG - Intronic
1079034268 11:17008713-17008735 CAGCCTTGGCACAGGCAAGGTGG + Intronic
1079081080 11:17414253-17414275 CAGCTAGAGAAAAGGCAGCGGGG + Intronic
1079306722 11:19329871-19329893 CAGCCTGTGCAAAGGCCTTGAGG + Intergenic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079629930 11:22661667-22661689 TAGCATGAGGAAAGGCATGGAGG + Intronic
1080031417 11:27665443-27665465 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1080042343 11:27772079-27772101 CAGCATAAGCAAAGTTAGGGAGG + Intergenic
1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG + Intergenic
1080634333 11:34110305-34110327 CAGCATGAGCAAAGAAAAGGAGG - Intronic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1080764083 11:35279518-35279540 CAGCCTGCACAAAGGCACTGAGG - Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081526836 11:43933396-43933418 CAGCCAGCGGCAAGGCAGGGTGG - Intronic
1081541590 11:44038522-44038544 CAGCATGTGCAAAGGCCCGGGGG + Intergenic
1081545850 11:44071109-44071131 CACCTTGAGCAAAGGCAAGGAGG + Intronic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1081686469 11:45046764-45046786 CAGCCTGACCAAAGGCTCAGAGG + Intergenic
1082798066 11:57392847-57392869 CAGCTTGAGCAAAGGTGTGGAGG + Intronic
1083239671 11:61378205-61378227 CAGCCTGGGCAACAGCAGGAAGG - Intergenic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1083380160 11:62260887-62260909 CAGCCTGGGCAAGGGCATGCAGG + Intergenic
1083616690 11:64029701-64029723 CAGCCTCAGCCAGGGTAGGGAGG - Intronic
1083768585 11:64854015-64854037 CAGCCACAGCAAAGGCCGGGGGG + Exonic
1083776902 11:64898446-64898468 CAGCGTGTTCAGAGGCAGGGTGG - Intronic
1084103590 11:66966090-66966112 CAGCCCAAGCACAGGCAGGAAGG - Intergenic
1084122434 11:67077512-67077534 CAGTCTGAGCGAAGGCTAGGAGG - Intergenic
1084208849 11:67611674-67611696 CAGCCTGAGATAAAGCAAGGTGG + Intronic
1084321403 11:68375438-68375460 CAGCACGAGCAGGGGCAGGGAGG - Intronic
1084419173 11:69051799-69051821 CAGCCTGAGTAAAGGGTTGGAGG + Intronic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1084676628 11:70639255-70639277 CACCCTGAGCAAAGGCCTGATGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085104618 11:73831406-73831428 GAGCATGTGCAAAGGCAGAGAGG - Intronic
1085135978 11:74088761-74088783 GAACATGTGCAAAGGCAGGGAGG - Intronic
1085189231 11:74603486-74603508 CATCCTGGGCAAACCCAGGGTGG - Intronic
1085282124 11:75338009-75338031 CGGCTTGAGCAAAGGCACAGAGG + Intronic
1085306432 11:75488587-75488609 CAACCTGAGTGAAGGCATGGAGG - Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085394207 11:76198509-76198531 AAGCTTGGGCAAAGGCATGGTGG - Intronic
1085404404 11:76253361-76253383 CAGCATAAGCAAAGACATGGAGG + Intergenic
1085410028 11:76285406-76285428 CAGCATGAGGAAAGGCAAGATGG - Intergenic
1085465784 11:76722357-76722379 CAGCTTGTGCAAAGGCGTGGAGG - Intergenic
1085716912 11:78880540-78880562 CAGCCTCAGCATAGTCAGTGTGG - Intronic
1085717148 11:78882358-78882380 CAGCATGGGCAAAAGCATGGTGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086171661 11:83843227-83843249 CAGCCTGGGCAAAGACAAGGAGG - Intronic
1086405177 11:86493422-86493444 CACCCTGTGCTAAGGCAGGGTGG - Intronic
1086571956 11:88295406-88295428 CAGCCTGGGCAAACGGAGTGAGG - Intronic
1086941016 11:92798650-92798672 CAGCCTGAGTAAAAACAGGTGGG - Exonic
1087345942 11:96971173-96971195 CAGCTTAAGCAAAGGTAGAGTGG + Intergenic
1087847880 11:102993804-102993826 CAGCATAAGTAAAGGCAAGGAGG - Intergenic
1088114210 11:106297581-106297603 CAGCCTGAGCCACTGCAGGAAGG - Intergenic
1088724134 11:112619608-112619630 GAGGCCCAGCAAAGGCAGGGTGG + Intergenic
1088789242 11:113209936-113209958 CAGCCTGGGCACAGGCACAGAGG + Intronic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1088977705 11:114830474-114830496 CAGCAAGAGCAAAGACAAGGAGG + Intergenic
1089083772 11:115799609-115799631 GGGTCTGAGCAAAGGCTGGGAGG + Intergenic
1089133751 11:116232998-116233020 CAGCATGTGCAAAGGTATGGAGG - Intergenic
1089209659 11:116791623-116791645 CAGCGGGGACAAAGGCAGGGTGG - Exonic
1089374997 11:117987963-117987985 GAGCCTGGGCCAAGCCAGGGTGG + Intronic
1089524460 11:119087882-119087904 CAGCCTGGCCACAGGAAGGGTGG - Intronic
1089567678 11:119380616-119380638 TAGCCTGTGCTAAGACAGGGTGG - Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089629096 11:119772719-119772741 CAGCCTGAGCACAGATGGGGTGG + Intergenic
1089770100 11:120796624-120796646 CAGCATTGGCAAAGGCATGGAGG + Intronic
1089784990 11:120901342-120901364 CAGCATGTGCCAAGGCAGGGAGG - Intronic
1089918658 11:122185388-122185410 CAGCCTGTGCAAAGGCCCAGTGG - Intergenic
1089957506 11:122585224-122585246 CCACGTGAGCAAAGGCAGGCAGG + Intergenic
1090246353 11:125218521-125218543 TAGGCTGAGCAAAAGCACGGAGG + Intronic
1090249465 11:125241294-125241316 CAGCATGTGCAAAGGCACCGAGG - Intronic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090422815 11:126587277-126587299 CAGCGTGTGCAAAGGCTGGGAGG + Intronic
1090919233 11:131193523-131193545 GAGCCTGAGAAAAGGCACGGAGG - Intergenic
1091116174 11:133015812-133015834 CAGCAGGAGCAAGGGCAGAGTGG - Intronic
1091232356 11:133996936-133996958 CAGCCTGGGCAAAGGAAGTTAGG - Intergenic
1091449891 12:565850-565872 CTGCCTGTGCCAATGCAGGGTGG + Intronic
1091640144 12:2230120-2230142 CATCCTGAGCACAGTCAGCGAGG - Intronic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1091960596 12:4690929-4690951 CAGCATGAGCAATTGCAGTGGGG + Exonic
1092004462 12:5057437-5057459 CAGCTTGAGCGAAGGCACAGAGG + Intergenic
1092006350 12:5073776-5073798 CAGGCTTGGCAAAGGCAGAGAGG + Intergenic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092071054 12:5631726-5631748 CAGCATGAGCAAGGCCGGGGTGG + Intronic
1092288342 12:7143005-7143027 GAGCCTGGGCAAAGGCATGAAGG + Exonic
1092529404 12:9332072-9332094 CAGCCTCAGGAGAGGCAGTGAGG - Intergenic
1092548379 12:9471232-9471254 CATCATTATCAAAGGCAGGGTGG + Intergenic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1093655277 12:21687602-21687624 CAGCCTGTGCAGAGCCAAGGGGG + Intronic
1093826118 12:23691144-23691166 CAGCCAGGCCAAAGGCAAGGAGG + Intronic
1094156001 12:27337498-27337520 CAGCCTGAGGAAAGGCCTGGAGG - Intronic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1094669065 12:32551151-32551173 CAGCATGAGCAAGTGCTGGGTGG + Intronic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1096044944 12:48554166-48554188 GAGCATGAGCCAAAGCAGGGTGG - Intergenic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096759832 12:53831950-53831972 GATCCTAAGCAAAGGGAGGGCGG + Intergenic
1097197962 12:57254725-57254747 CAGAAGGAGCAAGGGCAGGGTGG - Exonic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1098027056 12:66214839-66214861 TAGCCTGGGCAAAGTCAGTGAGG + Intronic
1098391811 12:69977564-69977586 TAGCCAGAGCAAAGCCAGGTTGG + Intergenic
1098638553 12:72813533-72813555 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
1098688083 12:73451102-73451124 AATCCTGAGCAAATGCAAGGAGG + Intergenic
1099806853 12:87531128-87531150 GAGCATGAGCCAAAGCAGGGTGG + Intergenic
1100242444 12:92723093-92723115 CTACCTGAGCCAAGGCATGGAGG + Intronic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1100739962 12:97581235-97581257 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1100790526 12:98125218-98125240 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1101055055 12:100903967-100903989 CAGCAGGAGCAAAGGTTGGGAGG - Intronic
1101119242 12:101562075-101562097 CAGCCAGGGCAAAGGCAAGCAGG - Intergenic
1101347581 12:103900814-103900836 CTGCATGGGCAAAGGCATGGAGG + Intergenic
1101351579 12:103934610-103934632 CATCCTGAATAAAGGCATGGAGG + Intronic
1101502319 12:105315673-105315695 CTGCATGAGCAAAGGTATGGTGG + Intronic
1101559969 12:105847621-105847643 CTGCCTGAGCCAAGGCACAGAGG + Intergenic
1101575304 12:105991695-105991717 CAGCATGAACAAAGGCCAGGGGG + Intergenic
1101617663 12:106354067-106354089 CAGCGTGAGCAATGGCATGAGGG - Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102044486 12:109821340-109821362 CAGCCTAGGCAAAGGCCTGGAGG - Intronic
1102242103 12:111331027-111331049 CAGCCTGAGCAAAGACATAGGGG + Intronic
1102514941 12:113440070-113440092 GAGCCTGAGCAAAGGAAAAGAGG - Intergenic
1102814989 12:115858487-115858509 CAGCATAAGCAAAGGCCTGGTGG + Intergenic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1102955668 12:117057067-117057089 TAGACTGGGCAAGGGCAGGGAGG + Intronic
1103201127 12:119088796-119088818 CAGCTTGAACAAAGCCAGAGAGG + Intronic
1103203662 12:119110790-119110812 GAGCATGAGCCAAAGCAGGGCGG - Intronic
1103208578 12:119149913-119149935 CAGCCTGGCCCTAGGCAGGGTGG + Intronic
1103208702 12:119150929-119150951 CAGCCTAGGCCAAGGTAGGGAGG + Intronic
1103256204 12:119543578-119543600 CAGCATGTGCAAAGGCCGAGAGG + Intergenic
1103935862 12:124476165-124476187 CAGCCTGTGCAAAGGCCCGGGGG - Intronic
1103948607 12:124540339-124540361 CAGCCTGTGCAAAGGCCCAGGGG + Intronic
1103994307 12:124819269-124819291 CAGCCTGTGCAAAGGCCCTGTGG + Intronic
1104441232 12:128794919-128794941 CTGCCTCAGAAAAGGCAGGAAGG - Intronic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1104599832 12:130145227-130145249 CAGCCTGAGCAAAGGTGGTGGGG - Intergenic
1104876583 12:132039104-132039126 CAAGCTGAGCACAGGCAAGGAGG - Intronic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106782797 13:33076696-33076718 TAGCCTGCGCATAGGCAGAGGGG + Intergenic
1106931538 13:34670966-34670988 CAGCCTCAGCCCAGGCATGGAGG + Intergenic
1107408339 13:40136177-40136199 CAGCGAGAGCAAAGGCCAGGTGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1108379016 13:49839294-49839316 CAGCTTGAGCAAAGGCTGAGAGG - Intergenic
1108533505 13:51348373-51348395 CAGCCTGAGGAGAGCCAGGATGG + Exonic
1108747735 13:53412078-53412100 CAGCTTGAGCAAAGGCATCTAGG + Intergenic
1109174053 13:59133427-59133449 CATCCTTTGCAAAGGCAGGGAGG - Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1110196996 13:72801017-72801039 CAGCCAATGCAAAGGCAGGGGGG + Intronic
1110356590 13:74574573-74574595 CAGCATGAACAAAGGCACTGAGG - Intergenic
1110699084 13:78526213-78526235 GAGCGTGAGCCAAAGCAGGGCGG + Intergenic
1110726383 13:78829553-78829575 CATCCTGTGCAAAGGCCTGGTGG + Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112078288 13:95936743-95936765 CAGTCTCTGCACAGGCAGGGTGG + Intronic
1112312337 13:98330114-98330136 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
1112323988 13:98431340-98431362 CAGACTGAGCCCAGCCAGGGAGG + Intronic
1112373524 13:98816786-98816808 CAGCCCAAGCAAAGGCAAGAGGG + Intronic
1112561757 13:100521411-100521433 CAGCCGGAGAAAGGGCTGGGCGG + Intronic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1113971562 13:114195178-114195200 AAGCCTGAAGGAAGGCAGGGAGG - Intergenic
1114146099 14:19979950-19979972 CAGTCTGAGAAAAGCCAGGAAGG - Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114672130 14:24416965-24416987 CAGGTGCAGCAAAGGCAGGGAGG - Exonic
1114678092 14:24459002-24459024 CAGCTTGGGCCAAGGCAGAGTGG + Intergenic
1115267078 14:31511802-31511824 CACAGTGAGCAAAGGCATGGAGG + Intronic
1117008602 14:51447508-51447530 CAGTCTGAGCAAAGGCCTAGAGG - Intergenic
1117253170 14:53954811-53954833 CAGCCTCAGGAAAGGGAGGTCGG - Intronic
1117376311 14:55121316-55121338 CAGCCTGATCAAAGCCAATGAGG - Intergenic
1117555218 14:56876936-56876958 CAGCATGTGCAAAGGTAGGAAGG + Intergenic
1117836771 14:59815929-59815951 CACCCTGAGCAAAGGCATGAAGG - Intronic
1117952640 14:61098231-61098253 GAGCGTGAGCCAAAGCAGGGCGG - Intergenic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118493178 14:66281591-66281613 CAACATGTGCAAAGCCAGGGAGG + Intergenic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1119196654 14:72722316-72722338 CAGCCTGTGCAGGGGCTGGGCGG - Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1119954747 14:78784866-78784888 CAGCCTGAGCAAAGTCACAGGGG + Intronic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120946719 14:90004777-90004799 CAGGCTGAGAGAAGGAAGGGAGG + Intronic
1121008778 14:90507670-90507692 TAGCCTGAGCAGAGGCACTGAGG - Intergenic
1121233002 14:92372154-92372176 CAGCCTGCTCAAATGCAGGGAGG + Intronic
1121233643 14:92376821-92376843 CAACCTGGGGCAAGGCAGGGGGG + Intronic
1121258465 14:92549196-92549218 CAACCTGACCCAAGGCAGCGTGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121339600 14:93097383-93097405 CAGCCTGAGGAAAGCCAAGAAGG + Intronic
1121409309 14:93738217-93738239 CAGCCTGTGCCAAGGGAGGGAGG - Intronic
1121501712 14:94443296-94443318 CAGCCTGAGCCATGGGAGAGAGG + Intronic
1121598088 14:95181125-95181147 CAGCCAGTGCAAAGGCACTGAGG - Intergenic
1121608233 14:95256930-95256952 CAGCAAGGGCAAAGGCTGGGTGG + Intronic
1121630986 14:95421823-95421845 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122234751 14:100325297-100325319 CAGCCTGGGCAAAGGCCAGGAGG - Intronic
1122245199 14:100397722-100397744 CAGAGTGTGCAAAGGCAGGGAGG + Intronic
1122281296 14:100623990-100624012 CAGCTGGAGCAAAAGCATGGAGG - Intergenic
1122466689 14:101938553-101938575 CAGCGTGTGCAAAGGCACTGGGG - Intergenic
1122597013 14:102900647-102900669 CAGCCTGAGTGAAGGCCGCGTGG - Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1122966011 14:105126375-105126397 CAGCAGGAGCCAGGGCAGGGTGG + Intergenic
1123018259 14:105385741-105385763 CAGCCTGGGGACAGACAGGGTGG - Intronic
1124249770 15:28099151-28099173 TAGCCTGGGAACAGGCAGGGAGG - Intronic
1124376847 15:29133938-29133960 CAGCCTGTGCAAAGGCTCAGAGG - Intronic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1125901998 15:43357191-43357213 CATCCTGAGGAATGGCAGGTTGG + Intergenic
1126142811 15:45451484-45451506 CAGCCTGAGCCAGGGCCAGGAGG + Intergenic
1126194440 15:45916728-45916750 CAGCCTGAGATGAGGCAAGGAGG - Intergenic
1126634368 15:50766627-50766649 CCACCAGAGCAAAGGCCGGGAGG - Intergenic
1126727883 15:51651460-51651482 CAGCCTGAACTAGGGCAGAGGGG + Intergenic
1126793645 15:52242873-52242895 CAGCATGAGTAAAGGCATGGAGG + Intronic
1126856479 15:52844406-52844428 CAGCCATAGCAAACACAGGGAGG + Intergenic
1127070059 15:55280310-55280332 CAGCCTGAGTAAACTCAGGCTGG - Intronic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127671452 15:61198929-61198951 GAGCCTCAGCAAAGGCAGGAAGG - Intronic
1127961732 15:63895338-63895360 CAGCTTGAGCAAAGACACAGAGG - Intergenic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128143027 15:65315637-65315659 CAGCCTGCAGAAAGGCCGGGAGG + Intergenic
1128156391 15:65394447-65394469 CAGCCTGAGCAATGGGCAGGTGG - Exonic
1128325910 15:66724032-66724054 CAGCTTGTGCAAAAGCAAGGAGG + Intronic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128357707 15:66939814-66939836 TGGCCTGAGCCAAGGCTGGGAGG - Intergenic
1128360116 15:66956090-66956112 CAGCATGGGCAAAGGCCCGGGGG - Intergenic
1128477860 15:68012772-68012794 CAGCATAAGCAAAGTCACGGAGG + Intergenic
1128484569 15:68072004-68072026 CAGCATGAGCAAAGGTAATGAGG + Intronic
1128554084 15:68618503-68618525 CAGTGTGATCAAAGGCTGGGAGG + Intronic
1128699431 15:69793619-69793641 CAGAGTGAGCAAAGGCACAGAGG - Intergenic
1128747976 15:70127956-70127978 GGGCGTGAGCAAAGGCAGTGAGG - Intergenic
1129168494 15:73793379-73793401 CAGCCAGTGCAAAGGCCGAGAGG - Intergenic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1129252294 15:74315722-74315744 CTGCGTGAGCAAAGGCACAGAGG + Intronic
1129283638 15:74506105-74506127 CTGCCGGTGCAAAGGCAGGGTGG - Intergenic
1129312456 15:74722247-74722269 CAGTCTGGGGAAAGGCAGGTGGG - Intronic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129355221 15:74986356-74986378 CCGCATGAGCAAAAGCAAGGAGG + Intronic
1129685711 15:77685064-77685086 CAGCTTGAGCAAGGGCCTGGAGG + Intronic
1129705829 15:77793512-77793534 CAGCCTGAGCAAAGGTGCAGTGG - Intronic
1129888604 15:79056155-79056177 CAGCATGTGCAAAGGCCAGGAGG + Intronic
1130094196 15:80844111-80844133 CCGCCTGAGCGATGGCTGGGTGG - Intronic
1130373638 15:83308857-83308879 CTTGCTGAGCAAAGGCACGGAGG - Intergenic
1130821635 15:87502227-87502249 CAGCCTGTGCAAAGGCATGGGGG - Intergenic
1130864242 15:87918475-87918497 TAGCATGAGCAAAGTCATGGAGG - Intronic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131223019 15:90600928-90600950 TGGCCTTAGCAAAGGCAGAGGGG + Intronic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1131249344 15:90820337-90820359 CAACCAGGGCACAGGCAGGGAGG + Intergenic
1131640121 15:94283409-94283431 CAGCCTGTGCAAAGCCAAGGGGG - Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1132511647 16:345370-345392 CAGGCTGAGAAATAGCAGGGGGG - Intronic
1132781566 16:1629271-1629293 CTGCCTGTGCAGAGACAGGGAGG - Intronic
1132839958 16:1974112-1974134 CAGCCTGGGGAAGGGCAGTGGGG + Intronic
1132860004 16:2065739-2065761 CACCCTCAGCAAATCCAGGGAGG - Intronic
1132918580 16:2369402-2369424 CAACATGAGCAAAGCCAAGGTGG - Intergenic
1133018732 16:2956579-2956601 CAGCGTGGGCAGAGCCAGGGAGG - Intergenic
1133410935 16:5568269-5568291 CAGCTTGGGCAAAGGCAAGGAGG - Intergenic
1133444967 16:5852210-5852232 CAGCATGGGCAAAGGCTAGGAGG - Intergenic
1133568980 16:7023083-7023105 CAGCCAGTGCAAAGGCACTGAGG + Intronic
1133631474 16:7626129-7626151 AAGCCTCTGCAAAGGCATGGAGG + Intronic
1133770057 16:8862677-8862699 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1134019727 16:10913125-10913147 CAGCCGGTGCAAAGGCCTGGAGG - Intronic
1134067736 16:11240057-11240079 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
1134084769 16:11348854-11348876 CAGCCTGTGCAAAGGCTTGAAGG + Intronic
1134118432 16:11566741-11566763 CAGCCTGGGCAGGGGTAGGGGGG + Intronic
1134397366 16:13877343-13877365 CAGCCTGAGAAAGGACAGGGTGG + Intergenic
1134858218 16:17538120-17538142 CTAGCTGGGCAAAGGCAGGGTGG + Intergenic
1135768690 16:25199722-25199744 CAGCCTTCGAAAGGGCAGGGCGG + Intergenic
1135775867 16:25257446-25257468 CAGGCTGAGGAAAGGCTGGGCGG + Exonic
1136069274 16:27778365-27778387 CAGCCTGGGCAAAGGCTGAGAGG + Intronic
1136096992 16:27963754-27963776 CAGCATGTGCAAAGCCATGGTGG - Intronic
1136289753 16:29264495-29264517 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1137066476 16:35850578-35850600 CAGCCTGACCAAAGCCACAGTGG - Intergenic
1137558275 16:49486816-49486838 CACCATGAGCAAAGGCATGGAGG + Intergenic
1137753065 16:50880741-50880763 CAGCCTGAGCAAGGGCCCTGGGG + Intergenic
1138224080 16:55277663-55277685 GAGCATGAGCAAAGGCCTGGAGG + Intergenic
1138404434 16:56778270-56778292 TAACCTGACCAAAGTCAGGGAGG + Intronic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1139332939 16:66207935-66207957 CAGCCAGTACAAAGGCACGGGGG - Intergenic
1139346670 16:66308193-66308215 TGGCCTGAGCAAAAGCTGGGAGG - Intergenic
1139384254 16:66554369-66554391 CCACCTGAGTAAAGGCATGGAGG + Intronic
1139435645 16:66935131-66935153 CCGCTTGAGCAAAGGCAGGAAGG - Exonic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139446776 16:67002961-67002983 CAGCCTGAGTGAAGCCAGGAAGG - Intronic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1139514270 16:67444141-67444163 GAGCCTGAGTAAAGCCAGAGTGG - Intronic
1139514462 16:67445132-67445154 CAGCATGTGCAAAGGCCTGGAGG + Intronic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1139837457 16:69850650-69850672 CAGCATGAGTGAAGGCAAGGAGG + Intronic
1139931014 16:70526065-70526087 TGGGCTGAGCAAAAGCAGGGTGG - Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1140250316 16:73289316-73289338 CATTCAGAGCAAGGGCAGGGTGG + Intergenic
1140285278 16:73597119-73597141 GAACCTGAGCCAGGGCAGGGAGG - Intergenic
1140663362 16:77208593-77208615 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1140735730 16:77896180-77896202 CAACTGGAACAAAGGCAGGGAGG - Intronic
1141624999 16:85256579-85256601 CAGCGTAAGCCAAGGCCGGGAGG - Intergenic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1141847098 16:86618300-86618322 TAGCTTGAACAAAGGCATGGAGG - Intergenic
1142095634 16:88237971-88237993 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1142815450 17:2421517-2421539 TAGCCAGAACAAAGGCAGTGCGG - Intronic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143014773 17:3885814-3885836 CAGCCAGGGCAAAGGCATGGAGG - Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143119971 17:4600360-4600382 CAGCCTGGGGGCAGGCAGGGTGG + Intronic
1143165869 17:4897041-4897063 CACCCGGAGGAAAGGCAGGCTGG - Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1143632779 17:8148319-8148341 CAGCCTGGGCCCAGGCAGAGTGG - Intronic
1143777710 17:9210192-9210214 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1143812530 17:9483860-9483882 CATCTTGGGCACAGGCAGGGTGG + Intronic
1144348276 17:14369480-14369502 GAGCCTGAGGAAAGGAATGGGGG + Intergenic
1144771546 17:17762313-17762335 CAGCATGTGCAAAGGCCTGGGGG + Intronic
1144840358 17:18182329-18182351 CAGCCTGGGCAAAGGCCAGGAGG + Intergenic
1145261253 17:21356027-21356049 CAGCCTGGGCAAAAGCCTGGAGG + Intergenic
1145284539 17:21495557-21495579 CATCCTAAGCAGAGGCAAGGAGG + Intergenic
1145305434 17:21671716-21671738 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1145800170 17:27677441-27677463 GAGCCTGAACAGTGGCAGGGAGG + Intergenic
1145813037 17:27776172-27776194 CTGCATGAGTCAAGGCAGGGAGG + Intronic
1146173803 17:30652005-30652027 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146347259 17:32068026-32068048 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146442336 17:32908014-32908036 AAGCCTGAGCAAAGGCCCTGAGG + Intergenic
1146508997 17:33429733-33429755 TTGCCTGAGCAAAGACAGAGAGG + Intronic
1146606954 17:34268794-34268816 TAGCCTGAGCAAAGTCATAGGGG + Intergenic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146663170 17:34678703-34678725 TAGCATGAGCAAAGGTATGGGGG - Intergenic
1146679027 17:34793689-34793711 CAGACTGGGCAAAGGCATGGAGG - Intergenic
1146938668 17:36828311-36828333 CAGCATAAGCAAAGGCACAGAGG + Intergenic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147650768 17:42060602-42060624 CAGCCGGAGCAAAGGCATTGAGG - Intronic
1147872355 17:43596533-43596555 CAGCATGAGCAAAGGCTTGGAGG - Intergenic
1147944352 17:44072022-44072044 CAGCCTGGGGGAAGGAAGGGAGG + Intronic
1147980760 17:44272649-44272671 CAGCCTGAGCCAAGGCAGCAGGG + Intergenic
1147987130 17:44313085-44313107 CAGGCTGAGCCAGGGCAGGGAGG - Exonic
1148204215 17:45769392-45769414 CATTGTGAGCAAAGGCCGGGAGG - Intergenic
1148773592 17:50080603-50080625 CACCCTGGGGAAAGGCATGGAGG - Intronic
1148874747 17:50680327-50680349 CAGCCTGGGCAAAGGAGTGGAGG + Intronic
1148965054 17:51428029-51428051 GAGCCCGCGCAAAGGCAGGGAGG + Intergenic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1149646759 17:58246654-58246676 CACCGTGAACAAAGGCAGGCAGG - Intronic
1149668536 17:58383964-58383986 AAGCTGAAGCAAAGGCAGGGTGG - Intronic
1149788282 17:59454809-59454831 CAGCCTGAACCAAGACAGGTAGG - Intergenic
1149864935 17:60146148-60146170 CAGAATGAGAAAAGGCATGGAGG - Intergenic
1149866416 17:60153690-60153712 GAGACTGAGCAAAGGCAGAGCGG + Intronic
1150303439 17:64064804-64064826 CAGCCTGAACAAAGGCCCCGGGG + Intronic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1151272982 17:73011258-73011280 GAGCTGGCGCAAAGGCAGGGGGG + Intronic
1151554020 17:74837571-74837593 CAGCCTGACCATTGTCAGGGTGG - Exonic
1151561274 17:74871128-74871150 CAGCGTGAGCCGAGGCAGGTGGG - Intronic
1151893143 17:76963033-76963055 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1151907007 17:77055173-77055195 GAGGCTGGGCAAAGGCAGGGAGG - Intergenic
1151944870 17:77314138-77314160 CAGCCTGGGCAAAGGGAGTAAGG + Intronic
1151966738 17:77435443-77435465 CTGCCTGAGCACAGGCTGGCAGG - Intronic
1151973666 17:77471916-77471938 GAGCCTGAGACAAGGCAAGGGGG + Intronic
1151977168 17:77489501-77489523 CACCCTGAGCCAGGGCTGGGAGG + Intronic
1152294843 17:79460953-79460975 CACACAGAGCAAAGGCATGGAGG - Intronic
1152301193 17:79495922-79495944 CAGCCTGAGCAGTGGCAGCGTGG + Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152717236 17:81906009-81906031 CTCCCTGAGCCAGGGCAGGGGGG - Intronic
1152929110 17:83100936-83100958 CAGCTTGAGCAGGGGCAGGCTGG + Intergenic
1153709695 18:7785026-7785048 CATCCTGTGTAAAGGCAGTGAGG + Intronic
1155394820 18:25376464-25376486 CAGCCTTAGCCATGGCAAGGGGG - Intergenic
1156486786 18:37471494-37471516 CAGCAGGGGCAAAGGCAAGGAGG - Intronic
1156979368 18:43266070-43266092 CAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1157305967 18:46518048-46518070 CAGCCTGGCTGAAGGCAGGGTGG + Intronic
1157824072 18:50796645-50796667 CAGACTGAGCAAAGGTGAGGGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158367032 18:56747724-56747746 CAGCCTGTGCAGATGCAGGTGGG + Intronic
1158633105 18:59133077-59133099 CAGCAGGAAAAAAGGCAGGGTGG + Intergenic
1158757326 18:60341630-60341652 AAGCCTGAGGAAAGGGAGAGAGG - Intergenic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159556528 18:69951495-69951517 CAGCCTGAGGACAAACAGGGTGG + Intronic
1159572120 18:70127638-70127660 CAGCCTGAACAATGGAATGGAGG + Exonic
1159798635 18:72869942-72869964 AAGCTTGAGCAAAGGGAGAGAGG + Intergenic
1159866417 18:73711499-73711521 CAGCCTCAGAAAAAGCTGGGTGG + Intergenic
1160295478 18:77633241-77633263 GGGCCTGGGCAGAGGCAGGGGGG - Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1160752038 19:738913-738935 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1160872736 19:1284543-1284565 CAGCCTGAACAAAGGTCAGGTGG + Intergenic
1160916822 19:1500737-1500759 CAGCCTGTGCAAAGGCCTTGAGG + Intergenic
1161258915 19:3324807-3324829 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161345426 19:3766791-3766813 CAGCCTGTGCAAAGGCCCCGGGG + Intronic
1161483279 19:4521481-4521503 CAGCCTCAGCAAAGGCCCGGAGG + Intergenic
1161501337 19:4617731-4617753 CAGCATGGGCAAAGGCCGGGTGG - Intergenic
1161502605 19:4624964-4624986 CAGCTTCAGCAAAGGCTTGGGGG - Intergenic
1161506350 19:4645931-4645953 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1161522252 19:4731111-4731133 CAGCCTGTGCAAAGGCCCTGCGG - Intergenic
1161533840 19:4806583-4806605 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161635308 19:5384970-5384992 CAGCCAGAGCAAAGGCCCTGCGG - Intergenic
1161650343 19:5480478-5480500 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161658828 19:5533442-5533464 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161662883 19:5558040-5558062 CAGCATGTGCAAAGGCCTGGAGG + Intergenic
1161664236 19:5565220-5565242 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1161795982 19:6387105-6387127 CAGCCTGCGGAAAGCCAAGGGGG + Intronic
1162156367 19:8680856-8680878 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1162400655 19:10444631-10444653 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162449805 19:10747949-10747971 CAGCCTGGGCAAAGGCCCTGGGG + Intronic
1162543010 19:11309477-11309499 AAGCCTGTGCAAAGGCGGTGAGG - Intronic
1162829986 19:13278359-13278381 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1162830097 19:13278984-13279006 CAGCCTGGTCAAAGGCCTGGTGG + Intronic
1162850981 19:13430950-13430972 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162932138 19:13962586-13962608 CAGCCTCAGCCAGGGCAGGGAGG - Exonic
1162988613 19:14288035-14288057 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163481665 19:17560140-17560162 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163561314 19:18021106-18021128 CTCCCTGGGCCAAGGCAGGGGGG - Intergenic
1163581912 19:18144341-18144363 CTGCATGAGCAAAGGCCAGGAGG + Intronic
1163770179 19:19186274-19186296 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1163867105 19:19782665-19782687 CAGTCTGAGGAGAGTCAGGGGGG + Intergenic
1164513607 19:28916315-28916337 TAGCCTGATCAGAGGCAAGGGGG - Intergenic
1164534713 19:29076528-29076550 CAGCCTGGGTCGAGGCAGGGCGG - Intergenic
1165162951 19:33828725-33828747 TGGCCTGAGCAAAGGAAGGATGG + Intergenic
1165323891 19:35102872-35102894 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1165937626 19:39398695-39398717 AGGCCTGAGCAAGTGCAGGGCGG + Exonic
1166217291 19:41343940-41343962 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1166314277 19:41980081-41980103 CAGCCTGTGCAAAGGCCCAGAGG - Intronic
1166388894 19:42397831-42397853 CAGCGTGACCAAAGACAGGGAGG + Intergenic
1166537880 19:43586628-43586650 CACTCCGAGCAAAGGCATGGGGG + Exonic
1166617232 19:44261086-44261108 CAGGCTGAGCTCAGGCAGAGTGG + Intronic
1166709932 19:44930350-44930372 CAGCCTGGGCATACGCAGGGAGG + Intergenic
1166794374 19:45417488-45417510 CAGCATGGGCAAAGGATGGGAGG + Intronic
1166860886 19:45810516-45810538 CAGCCTGTGCCAAGGCCTGGAGG - Intronic
1166893516 19:46008899-46008921 CAGCATGTGCAAAGGTTGGGGGG + Intronic
1167004461 19:46766649-46766671 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167562226 19:50232784-50232806 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167615822 19:50532518-50532540 GAGCCTGTGCAAAGGCAGAGAGG - Intronic
1167741920 19:51329028-51329050 CAGCCTGAGCTAAGAGAGAGGGG - Exonic
1167803727 19:51764213-51764235 CATCCTGGGCCAATGCAGGGAGG + Intronic
1168306112 19:55437158-55437180 CAGCCTGAACATCTGCAGGGTGG + Intronic
1168321280 19:55511469-55511491 CAGCGTGGGCAGAGGCTGGGAGG + Intronic
1168516717 19:57015330-57015352 CAACCTGAGTGAAGGGAGGGCGG - Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925198590 2:1947894-1947916 CAGCCTGAGCGTATCCAGGGTGG + Intronic
925710674 2:6736630-6736652 AATCCTGAGCAAAGGCTGGCTGG - Intergenic
926055679 2:9772663-9772685 CAGACTGGCCTAAGGCAGGGGGG - Intergenic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926352790 2:12012084-12012106 CAACATGAGCAAAGGTACGGAGG - Intergenic
926380674 2:12286009-12286031 GAGCCTGAGCCAAGGAAGGTGGG - Intergenic
926553957 2:14334792-14334814 GAGCTTGAGCAAAGGCCTGGAGG + Intergenic
926787909 2:16536672-16536694 CAGCATGTGCTAAGGCAGGAAGG + Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
927212023 2:20644938-20644960 CATCCTAAGCAAAGGCACGGAGG - Intronic
927460553 2:23294804-23294826 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
928970455 2:37022462-37022484 TAGCCTGAGCCCAGGCATGGTGG - Intronic
929579778 2:43074520-43074542 TAGCCTAAGCAAAGGCAGAGAGG + Intergenic
929668904 2:43853946-43853968 CCACCTGAGCACAGGGAGGGAGG - Intronic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
929868549 2:45738397-45738419 AGGCATGAGCAAAGGCAGAGAGG - Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929929079 2:46238237-46238259 CAGCCTGAGCAAAGGTGCAGAGG - Intergenic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930343112 2:50142834-50142856 CAGACTGAGCAAAAGCAAGAAGG + Intronic
930606353 2:53497225-53497247 CAGCCTGGGCAAAGGCTGGGAGG - Intergenic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
931273053 2:60719595-60719617 CAGCCTGAACAAAGGCACAGAGG + Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931384588 2:61786626-61786648 CCATCTGAGCAAAGGCATGGAGG + Intergenic
931560344 2:63554834-63554856 GAGACTGAGGAAAAGCAGGGTGG + Intronic
931898969 2:66766743-66766765 CTGCCTGCACAATGGCAGGGAGG + Intergenic
932195516 2:69779868-69779890 CACCCTGAGCAAAGGTACAGAGG - Intronic
932251217 2:70245950-70245972 CAGCCTGTGCAACAGGAGGGAGG - Intronic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933609831 2:84422335-84422357 CAGCCTGTGCAAAGTCAGGGAGG - Intergenic
933727715 2:85436004-85436026 CAGACTGAGCCATGGCAGGAGGG - Intronic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934091318 2:88553109-88553131 CAGCCCATGCAAAGGCATGGAGG - Intergenic
934323405 2:91985808-91985830 AAGGCTGAGCAGAGTCAGGGTGG - Intergenic
935277310 2:101486065-101486087 CAGCTTGTGCAAAGGCACTGAGG - Intergenic
935688337 2:105706893-105706915 CAGCCTGGGCAAAGGCACTGGGG - Intergenic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
938080472 2:128367391-128367413 AAGGCTGAGCAAAGGCAGTGGGG + Intergenic
938109678 2:128555477-128555499 CACCTTGTGCAAAGGCATGGAGG - Intergenic
938304855 2:130246184-130246206 CTGCCTGAGCAAAACCAGGAGGG - Intergenic
938449157 2:131401016-131401038 CTGCCTGAGCAAAACCAGGAGGG + Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
938782952 2:134601970-134601992 CAGCTTGAACAAAGGCTTGGAGG + Intronic
938923008 2:136012425-136012447 AAGCACGAGCAAAGGCAGAGAGG - Intergenic
939026496 2:137020226-137020248 TAGCTTGAGCAAAAGCAGAGGGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939364883 2:141218936-141218958 CAGAGTGAGGAAAAGCAGGGTGG + Intronic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
940909955 2:159201878-159201900 CAGGCTGTTCAAAGGCAGGCAGG - Intronic
941714940 2:168754059-168754081 CAGCATGAGGGAAGTCAGGGCGG + Intronic
942120775 2:172774464-172774486 AAGCTTGAGTAAAGGCATGGGGG - Intronic
942132417 2:172893263-172893285 ATGCCTGGGCAAAGGCAGGGAGG + Intronic
942237093 2:173921492-173921514 CAGCCTGAGCCAAGAGAGAGCGG + Intronic
942328870 2:174800641-174800663 CAGCCAGAGTGAAGGGAGGGTGG - Intronic
942408850 2:175685351-175685373 CAGCATGAGCAAAGGAAGAAAGG - Intergenic
943376517 2:187084300-187084322 CAGCTTAAGCAAAGGCAAAGAGG + Intergenic
943602547 2:189939110-189939132 CAGCCAGAGACAAAGCAGGGAGG + Intronic
943655210 2:190501407-190501429 CAGCCAGAACAATGGCTGGGTGG + Exonic
944198861 2:197084264-197084286 CAACCTGGACAAAGGTAGGGGGG - Intronic
944571771 2:201052266-201052288 CAGCCTGGGCAACAGGAGGGGGG + Intronic
944802369 2:203248734-203248756 TAGCCTGGGCAAAAGCTGGGCGG - Intronic
945143760 2:206715061-206715083 CAGACTGGGCAAAGGCATGGAGG + Intronic
945170444 2:206989581-206989603 CAGCCTGATGAAAGGTAGGAGGG + Intergenic
945186401 2:207144190-207144212 TAGACTGAGCAAAGGCTGGGTGG + Intronic
945670359 2:212795011-212795033 CAGGGTGAGCTAAGGAAGGGGGG + Intergenic
946104336 2:217355993-217356015 CAGCCTGAGCTAAGGCACTGTGG + Intronic
946166781 2:217869336-217869358 CAGCCTCTGAAAAGGCAGGGAGG + Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946239781 2:218346440-218346462 CAGCATGAGCGAAGGCACAGAGG - Exonic
946335282 2:219031572-219031594 CAGCCTGTGGCAGGGCAGGGTGG + Exonic
946528717 2:220548476-220548498 CAGCCTGAGCCAAGGCCTGGAGG + Intergenic
946827127 2:223690482-223690504 CAGCATGAACAAAGACATGGGGG - Intergenic
946879305 2:224161347-224161369 GAGCCAGAGAAAAGACAGGGAGG + Intergenic
946880205 2:224170016-224170038 CAGCCTGTGCAATGGAAGGCTGG + Intergenic
947551069 2:231047221-231047243 CAGACTTAGCAAATGCTGGGTGG - Exonic
947748545 2:232521615-232521637 TGGCCTGTGCAAAGGCAGGGAGG + Intronic
948033784 2:234841437-234841459 CAGCCTGGGCAACGGTAGGCTGG - Intergenic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948463623 2:238141987-238142009 CAGCTTGTGCACAGGCAAGGAGG + Intronic
948481665 2:238254185-238254207 CAGCCTGAGCAAGATCAGAGGGG + Intronic
948589398 2:239039516-239039538 CAGCCTGTGCAAAGGCCTGGAGG + Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
948910828 2:241001830-241001852 AGCCCTGAGCAGAGGCAGGGAGG + Intronic
949070114 2:242019386-242019408 GAGCCTGTGCAAAGGCCGGCGGG + Intergenic
1168792696 20:590571-590593 CATCCTGGGCAAAGGCTTGGTGG + Intergenic
1168837768 20:889053-889075 CAGCATGTGCAAAGGCCCGGAGG - Intronic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1168961880 20:1875649-1875671 CTGCATGAGCAAAGGTAAGGAGG - Intergenic
1168973764 20:1948910-1948932 CAGCCAGGGCAAAGGCTGGGAGG + Intergenic
1168978251 20:1983912-1983934 CAGCATGTGCAAAGGCCTGGGGG - Intronic
1168983999 20:2032052-2032074 CAGCAGGAGAGAAGGCAGGGGGG - Intergenic
1169011922 20:2258146-2258168 CAGGCTGGGAAAAGTCAGGGAGG + Intergenic
1169210617 20:3764439-3764461 TGACCTGGGCAAAGGCAGGGCGG - Intronic
1169249662 20:4050619-4050641 CAGCCAGTGCAAAGGCTGAGAGG - Intergenic
1169723211 20:8701328-8701350 GAGCCTGTGCAAAGGCTGTGAGG - Intronic
1169846843 20:10003149-10003171 CAGCAAGGGCAAAGGCAGAGAGG - Intronic
1170370926 20:15647310-15647332 CAGCCTGGGCAAAAGCACAGGGG + Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171522944 20:25789187-25789209 CAGCTTGAGCCAAGTCAGGATGG - Intronic
1171530688 20:25851156-25851178 CAGCTTGAGCCAAGTCAGGATGG - Intronic
1171553883 20:26066696-26066718 CAGCTTGAGCCAAGTCAGGATGG + Intergenic
1171851730 20:30313558-30313580 CAGCATGAGCAAAGGCTGCAAGG - Intergenic
1171961649 20:31498916-31498938 GATCTTGAGCAAAAGCAGGGAGG + Intergenic
1172095172 20:32456965-32456987 CAGCCTAGGCACAGGCACGGTGG + Intronic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172634150 20:36398369-36398391 CAGCATGGGCAAAGGCATGGAGG + Intronic
1172754320 20:37272736-37272758 CAGCCTGAGCAAAGGCTTGGAGG + Intergenic
1172774078 20:37397200-37397222 CAGCCAGAGCAAAGGCTCTGAGG - Intronic
1172776036 20:37407596-37407618 CAGCCTGGGCAAAGGCATGGAGG - Intergenic
1172776364 20:37409512-37409534 CAGCCTGTGCACAGGCAGGTGGG - Intergenic
1172783765 20:37452392-37452414 CAGCTTGAGCAAAGGCCAGAAGG - Intergenic
1172805555 20:37609278-37609300 CAGCCTAAGCAAAGTCAGAGAGG - Intergenic
1172808235 20:37628648-37628670 CAGCATGTGCAAATGCAAGGAGG - Intergenic
1172847012 20:37935526-37935548 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1172950131 20:38717969-38717991 CAGCCTGAGCTAAGACTGAGTGG - Intergenic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173011992 20:39191168-39191190 CACCCGGAGGCAAGGCAGGGAGG + Intergenic
1173157611 20:40627893-40627915 CTGCCTGAGAAAAGCCAGGAGGG + Intergenic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173462503 20:43254560-43254582 CAGCATGGTCAAAGGCAAGGAGG - Intergenic
1173471221 20:43325015-43325037 CAGCATGGGCGAAGGCATGGAGG - Intergenic
1173530651 20:43766869-43766891 CAGTATGAACAAAGACAGGGAGG - Intergenic
1173546647 20:43903064-43903086 CAGTAAGAGCAAAGACAGGGTGG - Intergenic
1173591909 20:44231433-44231455 CAGCCTCCCCAAAGGCAGGGAGG - Intergenic
1173620205 20:44430553-44430575 CAGCCTGAGCCAAGGCCTAGTGG + Exonic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173919434 20:46732895-46732917 CAGCAAGAGCAAAGGCCCGGAGG + Intronic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1173997698 20:47352151-47352173 CAGCCTGGGGGAAGGCAAGGAGG + Intronic
1174061406 20:47835556-47835578 CAGCATGTGCAAAGGCCTGGGGG - Intergenic
1174070120 20:47893767-47893789 CAGCATGTGCAAAGGCCTGGGGG + Intergenic
1174156273 20:48517458-48517480 CAGCATGTGCAAAGGCCTGGGGG - Intergenic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1174299655 20:49572273-49572295 CAGCATGAGCAAAGGTGTGGAGG - Intergenic
1174454061 20:50637295-50637317 CAGCCAGGGCAAAGGCTGGAGGG - Intronic
1174479433 20:50820458-50820480 CAGCCTGTGCAAAGGCGGGGAGG + Intronic
1174846794 20:53950289-53950311 CAGCCCTGGCAAAGGCACGGGGG - Intronic
1175839878 20:62020031-62020053 CAGACAGAGCCAAGCCAGGGCGG - Intronic
1175995282 20:62809527-62809549 CCTCCTGAGCACGGGCAGGGTGG + Intronic
1177388016 21:20432871-20432893 CAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1178318454 21:31586683-31586705 TGGCCTGAGCAAAGGACGGGGGG - Intergenic
1178393482 21:32219322-32219344 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1178482042 21:32987885-32987907 CAGCCTGAGCTAAGATAGGGAGG - Intergenic
1178522475 21:33298008-33298030 CAGCTTGAGCAAAAGCAGTCTGG + Intergenic
1178590328 21:33904278-33904300 CACACAGAGCAGAGGCAGGGAGG - Intronic
1178677338 21:34642384-34642406 CAACATGACCAAAGGCAGGTGGG - Intergenic
1179142633 21:38740107-38740129 AAGCAAGAGGAAAGGCAGGGGGG - Intergenic
1179409779 21:41153794-41153816 GTGCCTGGGCCAAGGCAGGGAGG + Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1180978768 22:19868829-19868851 CAGCATGGGCAAAGGCACAGAGG + Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181409856 22:22711218-22711240 CTCCCAGAGCAAAGGCAGGGAGG - Intergenic
1181499029 22:23305409-23305431 CACCCTCAGCAGGGGCAGGGAGG - Intronic
1181648093 22:24244593-24244615 CAGCGTGGGCAAAGGCCTGGGGG + Exonic
1181761995 22:25065074-25065096 CTGCCTGAGCATAGGCAGGGAGG + Intronic
1181771234 22:25127292-25127314 CAGCTTGTGCAAAAGCTGGGAGG - Intronic
1181906437 22:26200887-26200909 CAGCTTGAACAAAGGCTGAGAGG - Intronic
1181911271 22:26240181-26240203 CAGCATGAGCAAAGGTGTGGGGG - Intronic
1181928947 22:26383805-26383827 CAGGCTGAGCTAAGAGAGGGAGG - Intergenic
1181991586 22:26841103-26841125 CAGCCTGGGCAAAGGCCCGGAGG + Intergenic
1181998989 22:26904655-26904677 CAGCATGTGCAAAGGCCTGGTGG + Intergenic
1182127304 22:27825383-27825405 CAGCATGTGCAAAGGCCTGGAGG - Intergenic
1182455253 22:30446338-30446360 TGGCCTGAGCAAAGGCAGGGAGG - Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182898660 22:33879550-33879572 CAGGAAGAGCAAAGACAGGGAGG - Intronic
1183090363 22:35518253-35518275 GCTCCTGAGCAAAGGCTGGGAGG + Intergenic
1183334868 22:37240843-37240865 CAGCTTGAGCAAAGGCCCTGGGG + Intronic
1183647470 22:39134799-39134821 CAGCATGAGCAAAGGTGTGGCGG - Intronic
1183727074 22:39596115-39596137 CAGAGTGAGCCAGGGCAGGGCGG + Intronic
1183789607 22:40055378-40055400 CAGCCTGTGTAGAGGCATGGGGG + Intronic
1183791709 22:40076595-40076617 TAGCCTGGGCAAAGGGAGAGAGG - Intronic
1183951434 22:41355154-41355176 CAGCCTGTACAAACGCAGGGAGG + Intronic
1184148441 22:42624789-42624811 CAGGCTGGGCAAGGGCGGGGTGG + Intronic
1184275850 22:43409358-43409380 CAGCCTGTGCAAAGGCTCAGAGG - Intergenic
1184536992 22:45094195-45094217 TAGCCTGAGCAGCGGGAGGGTGG - Intergenic
1184642316 22:45879201-45879223 CAGCCTGGGGAGAGGCAGAGGGG + Intergenic
1185083782 22:48724866-48724888 CAGCCTGCGGCATGGCAGGGAGG + Intronic
1185214875 22:49593019-49593041 CAGCCTGAGAACAGTCAGGCTGG - Intronic
1185256123 22:49833050-49833072 CAGCCCAAGAAAAGGCAAGGAGG + Intergenic
949951896 3:9236149-9236171 CAGCATGTGCAAAGGTATGGGGG - Intronic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
950175332 3:10869545-10869567 GAGACTGAGAAAAGGCAAGGAGG + Intronic
950280854 3:11706775-11706797 CAGTCTGAGAAAAGGCACAGGGG + Intronic
950395203 3:12728726-12728748 CAGCATGGGCAAAGGCGTGGAGG - Intergenic
950537570 3:13588522-13588544 CTGCCAGAGCAAAGCCAAGGTGG - Intronic
950635203 3:14309174-14309196 CAGCAAGAGCAAAGACAGGGAGG + Intergenic
950659840 3:14460507-14460529 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
950900783 3:16495621-16495643 CAGCAAGAGCAAAGGCATGGAGG + Intronic
951234757 3:20221152-20221174 CAGCCAGAGCAAAGGCCTGAAGG - Intergenic
951275429 3:20679398-20679420 TAGCATGTGCAAAGGCAGAGAGG + Intergenic
952514035 3:34085681-34085703 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
953386662 3:42510185-42510207 CAGCGTGTGCACAGGCATGGAGG - Intronic
953606708 3:44417318-44417340 CAGCTTGAGCAAAGCTATGGAGG - Intergenic
953697421 3:45170903-45170925 CCACCTGAGCAAAGGCCTGGGGG - Intergenic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954286992 3:49626110-49626132 CATCCTGAACAAAGCCAGGCTGG - Intronic
954605102 3:51903329-51903351 CAGCCATAGCATAGGCAGGAAGG + Exonic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
954794728 3:53155730-53155752 CAACCTGAGCAGAGGCTTGGTGG + Intergenic
955056602 3:55460812-55460834 CAGCTTGAGCAAAGGCCAAGAGG - Intergenic
955630341 3:60966403-60966425 GAGCATGAGCCAAAGCAGGGCGG - Intronic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
956078977 3:65537215-65537237 TAGCTTGAGCAAAGGCATGTTGG - Intronic
956176966 3:66482090-66482112 CAGCCTGGGCACAGGCAGGCTGG + Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
958784011 3:98577115-98577137 CAGCCTGAGAAAAGGCCAGAGGG + Intronic
959024955 3:101230597-101230619 GAGCATGAGCAAAGTCAGGGAGG - Intronic
959120201 3:102223371-102223393 GAGGTTGAGCAAAAGCAGGGTGG - Intronic
959542784 3:107559012-107559034 TAGCCTGAGAAAAGGCATAGTGG + Intronic
959585313 3:108020242-108020264 CAGCCTGAACAAACACATGGGGG + Intergenic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
960916834 3:122703386-122703408 CAGCATGAACATAGGCATGGTGG - Intronic
960947313 3:122975428-122975450 CAGGCTGTGCCGAGGCAGGGGGG - Intronic
961009713 3:123427461-123427483 CAGCAGGAGCGAAGGCATGGTGG - Intronic
961082892 3:124041696-124041718 CATCCAGAGAAAAGGCAGGAAGG - Intergenic
961107532 3:124254902-124254924 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
961181804 3:124883777-124883799 CTGTCTTAGCAAAGGCAGCGTGG + Intronic
961184581 3:124903419-124903441 AAGCATGAGCAAAGGAATGGAGG + Intergenic
961357554 3:126348722-126348744 GAGCCTGAGCCACAGCAGGGAGG + Intronic
961809065 3:129511040-129511062 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
962410853 3:135140730-135140752 CTGCTTGAGCAATTGCAGGGAGG + Intronic
962580701 3:136795359-136795381 CAGCTTGAGCAAAGGCCGAGAGG + Intergenic
962851307 3:139310149-139310171 TAGCATGGGCAAAGGCATGGAGG + Intronic
962887728 3:139642892-139642914 CAGCAGGATCAAAGGCATGGAGG - Intronic
963299393 3:143581898-143581920 CAGCCTCAGAAAAGCCAGGCAGG - Intronic
963484103 3:145914369-145914391 CAAGCTTAGCAAAGGCAGGAGGG - Intergenic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
963853953 3:150235293-150235315 CAGCATGGGCAAAGGCAGATTGG - Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
967307660 3:188074813-188074835 CAGCCTGGGCAACGGCGGGGTGG + Intergenic
967311122 3:188107307-188107329 CACGCTGAGCGAAGACAGGGAGG - Intergenic
967889991 3:194358129-194358151 CAGCCTGTGCAAAGGCCCCGTGG - Exonic
967922791 3:194625259-194625281 CAGCATGGGCAAAGGCTAGGAGG - Intronic
967990984 3:195130660-195130682 CAGCCTGAGCAAAGCACTGGAGG + Intronic
968016388 3:195337978-195338000 CAGCCAGTGCAAAGGCATTGAGG - Intronic
968938084 4:3624070-3624092 CAGCCTGAGCCAGAGCTGGGAGG - Intergenic
969166407 4:5319608-5319630 CAGCATGAACAAAGGCTGAGAGG - Intronic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969278240 4:6151442-6151464 CAGCTTGGGCAGAGGCATGGAGG - Intronic
969325472 4:6441520-6441542 CAGCCTGAACAGAGGCGAGGTGG - Intronic
969351398 4:6600026-6600048 CAGCCCAGGCAGAGGCAGGGAGG + Intronic
969377381 4:6771777-6771799 CAGCATTTGCAAAGGCAGAGAGG + Intergenic
969397156 4:6929533-6929555 CAGCTTGTGCAAAGTCATGGGGG + Intronic
969507779 4:7598836-7598858 CAGCATGAGCACAGCCTGGGGGG - Intronic
969515717 4:7647127-7647149 CAGCTTGCGCAAAGGCCTGGAGG + Intronic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969651315 4:8469821-8469843 CTGCCTGAGGACAGGCTGGGTGG - Intronic
969662245 4:8537077-8537099 CAGCCTGAGCAAAGGCTGAGAGG + Intergenic
969687137 4:8681945-8681967 CAGGCTGAGCAGAGCCAGAGTGG - Intergenic
969707824 4:8821373-8821395 CACCTTGAGCAAAGGCCTGGAGG + Intergenic
970174729 4:13327952-13327974 CATCCTGTGCAAAGGCTCGGAGG + Intergenic
970177151 4:13350777-13350799 GAGACTGAGCAAATACAGGGTGG + Intergenic
970423279 4:15924546-15924568 TAGCCTGGGCAAAGGCTTGGAGG - Intergenic
970491529 4:16580116-16580138 CATGCTGTGCAAAGGCATGGAGG + Intronic
971796932 4:31240029-31240051 CAACCTGACAAAAGGCAGGATGG + Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972267772 4:37479629-37479651 CAGCATGTGCAAAGGCTCGGTGG + Intronic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972323235 4:37991916-37991938 CTGCATGAGCAAAGGTATGGAGG + Intronic
972629689 4:40832631-40832653 TGGCCTGAGCACAGGCAGGGAGG - Intronic
972630134 4:40835493-40835515 AGGTATGAGCAAAGGCAGGGAGG + Intronic
973258585 4:48137905-48137927 CAGCTTGAGCAAAGGTAAGGAGG - Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
973824480 4:54691548-54691570 CAGCCTAAGGAGAGGCAGGTTGG + Intronic
973855397 4:55006067-55006089 CAGCCTGAGCAAAGGCCCTGAGG + Intergenic
975487248 4:74948020-74948042 TGGCATGAGCAAAGGCAGAGAGG - Intronic
975558345 4:75686541-75686563 CAGCAAGAGCAAAGGGTGGGTGG + Intronic
975695778 4:77011479-77011501 CAGCGTGAGCAAAGACACAGAGG + Intronic
975877972 4:78867016-78867038 CAGCCTGAGCAATGGCATGGTGG + Intronic
976370727 4:84285779-84285801 GAGGCTGAGCCAAGGCAGGGTGG + Intergenic
976527944 4:86115328-86115350 CAGAGTGAGGAAAAGCAGGGTGG - Intronic
977152074 4:93525305-93525327 GGGCCTGAGCAAAGGCATGAAGG + Intronic
977312343 4:95403287-95403309 CAGCCTGAGCAAACTCATGTTGG + Intronic
978392667 4:108243355-108243377 AGGACTGAGCAAAGGCAGTGGGG + Intergenic
978856160 4:113397282-113397304 CTGCGTGAGCAAAACCAGGGAGG + Intergenic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
981934733 4:150227546-150227568 CAGTCTGAGCAAAGGCCCAGAGG + Intronic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
983259029 4:165434962-165434984 AAGCCAGAGCAAAAGAAGGGAGG - Intronic
983373682 4:166897439-166897461 CTGCATGAGCAAAGGTTGGGTGG + Intronic
984316029 4:178133610-178133632 CAGCCAGAGCAAAGGCTGTCAGG + Intergenic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
985614567 5:911668-911690 CAGCGAGAGCAAAGGCTGGGGGG + Intronic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
986575797 5:9211570-9211592 CAGCCTGAGCACAGCTAGGGTGG - Intronic
986658514 5:10038504-10038526 AAGCCTGAGCAAATGCAAGGAGG - Intergenic
987072305 5:14350174-14350196 CACCCTAAGGAAAGGCAGGCAGG + Intronic
988852817 5:35196233-35196255 TAGGCTGTGAAAAGGCAGGGAGG + Intronic
989265153 5:39464762-39464784 CAACATGAGGAAAGGCAGGAAGG - Intergenic
990633000 5:57691427-57691449 CAGCCAGTGCCCAGGCAGGGAGG - Intergenic
991473355 5:66993640-66993662 CAGGATGTGCAAAGGCAGTGAGG + Intronic
991627718 5:68621654-68621676 CAGCATGAGCAAAGATATGGAGG - Intergenic
992150180 5:73895005-73895027 CAGGCTGAGGGAAGGGAGGGTGG + Intronic
992431870 5:76717520-76717542 CACCCTGAACAAAGACAGAGAGG - Intronic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992500476 5:77337958-77337980 GAGCCTGAGCAAAACCAGGCAGG - Intronic
992642436 5:78779745-78779767 CAGAGTGAGCAATGGCTGGGGGG + Exonic
993055623 5:82976037-82976059 CAGAATGAGCCAAGGCAGGCAGG + Intergenic
994059236 5:95455786-95455808 CAGCCTGAGCAAAGGCCTGGAGG + Intergenic
994794054 5:104270845-104270867 TAGCATGAGCAAATGCAGAGAGG + Intergenic
995341958 5:111070496-111070518 CCGCATGAGCCAAGCCAGGGAGG + Intronic
995454840 5:112340076-112340098 CAGCATGAGAAAAGTCACGGAGG + Intronic
997196866 5:131986106-131986128 CAGCCTGGGCACAGGCACAGAGG + Intronic
997392577 5:133529010-133529032 CAGCCGGAGCAAGAGCATGGAGG - Intronic
997698617 5:135880766-135880788 CAGCCTGAGCAAAGACCTAGGGG - Intronic
997983155 5:138482852-138482874 CAGCAAGTGCAAAGCCAGGGAGG + Intergenic
998140790 5:139698220-139698242 TGGCCTGAGCAAAGCCAGGCAGG - Intergenic
998522739 5:142815661-142815683 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
998847775 5:146327558-146327580 CAGCTTTAGCAAAGGGAAGGAGG - Intronic
998980729 5:147699061-147699083 TAGCATGAGCAAAGGCCTGGGGG - Intronic
999085454 5:148884759-148884781 CAGCATGAGCAAAGACTGAGTGG - Intergenic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
999190187 5:149741478-149741500 CTGCTTCTGCAAAGGCAGGGTGG - Intronic
999241681 5:150131603-150131625 CAAGCTGCACAAAGGCAGGGAGG + Intronic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
1000196000 5:158958504-158958526 CTGACTGAGTAAGGGCAGGGCGG - Intronic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1000912216 5:167036176-167036198 CAGCCTGGGGAAAGTCTGGGAGG + Intergenic
1001138589 5:169123775-169123797 CAGTCAGAGCAAAGGCAGACTGG + Intronic
1001255978 5:170183888-170183910 CAGCCTGGGAAGTGGCAGGGTGG - Intergenic
1001315325 5:170637590-170637612 CAGCCTGAGCAAAGGCCTTGAGG - Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001542047 5:172546408-172546430 CAGAGTGAGCGAGGGCAGGGGGG + Intergenic
1001597532 5:172907652-172907674 CAGCATGTGCAAAGGCCTGGAGG - Intronic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1001951229 5:175818019-175818041 CAGCCTGGGGCCAGGCAGGGTGG - Intronic
1002045569 5:176539920-176539942 TAGCCTGAGCAAAGGCAGGAAGG - Intergenic
1002062156 5:176631563-176631585 CAGCATGGGCAAAGGCACTGTGG + Intronic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002575776 5:180172880-180172902 GAGCATGGGCAAAGGCATGGAGG - Intronic
1002595995 5:180323713-180323735 CACCCCAGGCAAAGGCAGGGAGG + Intronic
1002605775 5:180381891-180381913 CGGCCTAAGCAAAGCCATGGGGG - Intergenic
1002709539 5:181186368-181186390 CAGCCTCATCTGAGGCAGGGGGG - Intergenic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1003352717 6:5333616-5333638 CACCTTGAGCAGAGGCAGGCAGG + Intronic
1004366049 6:15013606-15013628 CAGTATGGGCAAAGGCAGAGAGG - Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1004861931 6:19813202-19813224 CAGCCTGAGTAAAGACAGGAGGG - Intergenic
1004938665 6:20532804-20532826 CAGCCAGAGCAAAAGCAAGGAGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1006275523 6:33002241-33002263 TAGTTTGTGCAAAGGCAGGGAGG + Intergenic
1006502721 6:34468600-34468622 CAGCCTGTGCAAAGGCCTGCAGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1007081607 6:39109171-39109193 CAGCCTGAGCCAAGGCCTGGAGG + Intronic
1007228196 6:40329305-40329327 CAGCATGAGCAGAGGTTGGGAGG + Intergenic
1007289564 6:40775179-40775201 CAGCATGTGCAAAGGCAAGCAGG - Intergenic
1007346697 6:41236499-41236521 CCACCTGAGCCAAGGCAGGCAGG - Exonic
1007410075 6:41656498-41656520 CCACCTGGGCAAAGACAGGGAGG - Intergenic
1007506286 6:42337726-42337748 TAGCATAAGCAAAGGCATGGAGG + Intronic
1007692419 6:43711346-43711368 CAGCTGGAGCAAAGGCCGTGAGG + Intergenic
1007746983 6:44049156-44049178 CAGCATGGACAAAGGCATGGAGG - Intergenic
1007833209 6:44654640-44654662 CAGGCAGAGCAGCGGCAGGGAGG - Intergenic
1007968924 6:46030711-46030733 CAACATGAGCAAAGGCATGGAGG - Intronic
1008071945 6:47106878-47106900 CAGCCAGTGCCAAGGCATGGAGG - Intergenic
1008496031 6:52135420-52135442 CAGCTTGAGCAAAGACATAGTGG - Intergenic
1009635754 6:66262520-66262542 CAGTCTGAGGAAAGTCAGGAAGG - Intergenic
1009878567 6:69537005-69537027 CAGCCTGAGCAAACGAATAGAGG - Intergenic
1010142543 6:72627784-72627806 CAGCATGAGCAAACACATGGTGG - Intronic
1010148799 6:72705056-72705078 TAGATTGAGCAAAGGCAGAGAGG - Intronic
1010762123 6:79735420-79735442 CAGCCTATGCAAAGGCACAGAGG - Intergenic
1011139310 6:84134641-84134663 GAGGGTGAGCCAAGGCAGGGTGG - Intronic
1011207467 6:84915195-84915217 CAGCCAGAGCAAAGCCTGTGAGG - Intergenic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1011706129 6:90003234-90003256 CAGAGTGAGCCAAGGCAGGGTGG - Intronic
1011727331 6:90223495-90223517 CAGCCTGGGCAACTGCAGTGAGG - Intronic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1012237757 6:96837793-96837815 CCGCCTGGGCAAAGGCATCGAGG + Intergenic
1013071303 6:106731805-106731827 CAGCACGTGCAAAGGCACGGAGG - Intergenic
1013183990 6:107741490-107741512 CAGCCAGAGACAAAGCAGGGAGG + Intronic
1013503817 6:110779233-110779255 ATACCTGTGCAAAGGCAGGGTGG - Intronic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015509595 6:134024546-134024568 CAGCCTGAGCAATTGCAGCAGGG - Intronic
1015633766 6:135255922-135255944 CAGCGTGTGCAAAGCCAGGGAGG - Intergenic
1015998109 6:139015163-139015185 CAATCAGAGCAAAGGCAGGAAGG + Intergenic
1016097914 6:140060798-140060820 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1016349827 6:143155331-143155353 CAGCATGTGCAAAGACAAGGGGG + Intronic
1016506505 6:144786618-144786640 AAGCCTGAGCAAAGGCACAGAGG - Intronic
1017220800 6:151963099-151963121 GAGCAAGAGCAAAGGAAGGGAGG - Intronic
1017855102 6:158343728-158343750 CAGCCTGAACTAAGACAGGCAGG + Intronic
1018435167 6:163752673-163752695 CAGCAGGAGCAAGGGCAGAGAGG + Intergenic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019601240 7:1884803-1884825 CAGCCTGAGCCACAGCAGGGAGG + Intronic
1019698258 7:2459989-2460011 CAGCAGGAGCAAAGGCTTGGAGG + Intergenic
1019921491 7:4166199-4166221 CTGCCTGGGCAAAGGCAGGGAGG + Intronic
1020015503 7:4829179-4829201 CAGCCTGACCCACGGCAAGGAGG - Intronic
1021906392 7:25338478-25338500 CAGCCTGAGCAGGGGAATGGGGG + Intergenic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1022449771 7:30504327-30504349 CAGCCGGTGCAAAGGCCAGGAGG + Intronic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022616576 7:31937072-31937094 CAGCCTGAGTTAAGATAGGGGGG + Intronic
1022822937 7:33979246-33979268 CAGCATGAGCAAAGGACTGGAGG - Intronic
1023119933 7:36899050-36899072 CAGCCTGAGTGAAGGCTTGGAGG + Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1025020514 7:55476265-55476287 CAGGCTCAGCAAAGACTGGGAGG + Intronic
1025283382 7:57644113-57644135 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1025777036 7:64569135-64569157 CAGCCTGAGCTAAGAGAGAGGGG + Intergenic
1026359815 7:69592485-69592507 CAGCATGAGCAAAGGTGTGGGGG + Intergenic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1028584408 7:92438727-92438749 CACCCTGAGCCAAGGCATGAGGG + Intergenic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029543832 7:101200120-101200142 CTGCCTGAGCTTAGGCAGCGGGG + Intronic
1029599641 7:101556134-101556156 TGGCCCGAGCAAAGGCATGGAGG - Intronic
1029727368 7:102415948-102415970 CAGCCTAAGCACATGCAGCGAGG - Intronic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1030017012 7:105232989-105233011 CAGCCTAGGCAAAGGAAAGGAGG + Intronic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030083043 7:105793809-105793831 TGGCCTGATCACAGGCAGGGAGG + Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030097077 7:105909943-105909965 CCACTTGAGCAGAGGCAGGGAGG + Intronic
1030142568 7:106320319-106320341 GAGCATGAGCCAAAGCAGGGAGG + Intergenic
1030167731 7:106571588-106571610 CACCCTGAACATGGGCAGGGGGG - Intergenic
1031265319 7:119573013-119573035 CAGCCAGAGCAAAGACAATGGGG + Intergenic
1031454384 7:121961365-121961387 GAGCCTGAGCAAACTCATGGTGG - Intronic
1031829748 7:126612367-126612389 TAGCCTGAGCAAAGACAGAATGG - Intronic
1031891263 7:127295589-127295611 CAGCCTGAGCGATGTCCGGGTGG - Intergenic
1032666337 7:134040394-134040416 CAGCCAGAATAAAGGCATGGAGG - Intronic
1032706388 7:134423963-134423985 CAGCCTGAGCCAAGGCACAGGGG + Intergenic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1033293499 7:140109234-140109256 GAGCGTGAGCCAAAGCAGGGCGG - Intronic
1033449423 7:141449424-141449446 TAGCCTGACCCAAGGAAGGGGGG + Intronic
1033718123 7:144024387-144024409 CAGCCTGAACAAAGACAAGGAGG - Intergenic
1034531593 7:151699279-151699301 CAGCCTGACCGCAGGGAGGGAGG - Intronic
1034625040 7:152485964-152485986 CTGCGTGAGCAAAGGCACAGAGG - Intergenic
1034981992 7:155485035-155485057 CAGCCTGAACAAAGGCCAGCAGG + Intronic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035597397 8:869584-869606 CAGCCTTGGAAAAGACAGGGAGG - Intergenic
1035679733 8:1479098-1479120 CAGGGTGAGCCCAGGCAGGGGGG + Intergenic
1036147785 8:6270567-6270589 CAGCCTGTGCAAAGGCCGTGAGG + Intergenic
1036743911 8:11390695-11390717 GAGGCTGGGCAAAGGCAGAGGGG + Intronic
1036750896 8:11443259-11443281 CAGCCTGAGAACAGGGTGGGGGG - Intronic
1036804487 8:11820561-11820583 AAGCCTCAGCAATGGCGGGGAGG + Intronic
1037109989 8:15154366-15154388 CAGGCTGAGCAAAAGCTGGGTGG - Intronic
1037597879 8:20369565-20369587 CAGCATGGGCAAAGACTGGGTGG - Intergenic
1037892134 8:22628999-22629021 GAGGCTCAGCGAAGGCAGGGAGG - Intronic
1038011513 8:23480210-23480232 GAGCCAGAGCTAAGGGAGGGCGG + Intergenic
1038033310 8:23663497-23663519 GGGCCTAAGCAAAGGCAGGGAGG - Intergenic
1038416401 8:27399348-27399370 CAGCATGTCAAAAGGCAGGGAGG + Intronic
1038423145 8:27446357-27446379 CAGCCTGAACAAAAGCAGAAAGG - Intronic
1038491797 8:27976953-27976975 CAGCCTGGACTAAGGCAGGGGGG - Intronic
1039483443 8:37892852-37892874 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1039759368 8:40558157-40558179 TTGCCTGAGCCAAGGCAGGGAGG + Intronic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1039870885 8:41544158-41544180 CAGCCTGTGCAAAGGCCCTGAGG + Exonic
1039968166 8:42298936-42298958 CAGCCAGCGCAGGGGCAGGGAGG - Intronic
1040980920 8:53245503-53245525 CAGCCTCAGCAAACTAAGGGAGG + Intronic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1042471720 8:69197130-69197152 CAGCATAAGCAAAGACAGTGGGG - Intergenic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045213630 8:100124825-100124847 CAGCATTGGCAAAGGCAAGGAGG + Intronic
1045265385 8:100614363-100614385 CAGACAGAGGAAAGGCATGGGGG + Intronic
1046044620 8:108948849-108948871 CTGCCTGAGCTAAGCCAGGAAGG - Intergenic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1046354152 8:113057018-113057040 CAGCATGTGCAAAGGCCTGGTGG - Intronic
1046657786 8:116913511-116913533 GAGAGTGAGGAAAGGCAGGGTGG - Intergenic
1046794336 8:118354416-118354438 TAGCATGAGCAAAGGCTGGGAGG - Intronic
1046818255 8:118608834-118608856 CAGCCTAAACAAAGACAGGAGGG + Intronic
1046958170 8:120083032-120083054 CATCCTTAGGAAAGGGAGGGAGG + Intronic
1047762295 8:127963181-127963203 CAGCCTGGGCAGGGGCAGGAAGG - Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048332207 8:133478602-133478624 CAGCCTGAGCAGGGACACGGAGG - Intronic
1048509599 8:135050285-135050307 CAACTTGAGTAAAGTCAGGGTGG - Intergenic
1049100312 8:140574456-140574478 CAGCCTGAGCAACATAAGGGAGG - Intronic
1049224349 8:141442518-141442540 CAGCCTGGGCAAGGGCACAGAGG + Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049415213 8:142491919-142491941 CAGCTGGAGCAAGGGCAGGGAGG + Intronic
1049476747 8:142800402-142800424 AAGCCTGAGAAAGGGCAGTGGGG - Intergenic
1049579268 8:143404053-143404075 CAGGGTGGGCAAAGGCTGGGAGG - Intergenic
1049602355 8:143513842-143513864 CAGCCTCAGCAAAGGCTGTGAGG - Intronic
1049666358 8:143845143-143845165 CAGCCTGAGTGAGGCCAGGGAGG - Intergenic
1049701942 8:144019196-144019218 CAGCCTGAGGGCAGGCATGGGGG + Intronic
1050340050 9:4627784-4627806 CAGCCTCAGCAAAAGAAAGGTGG + Intronic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051423309 9:16910156-16910178 CAGCCTGAACAAAGACACAGAGG + Intergenic
1051596727 9:18831398-18831420 CAGCCTGGTCACAAGCAGGGTGG + Intronic
1052610619 9:30768928-30768950 CAGCATGGGCAAAGGCATGGGGG + Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053150949 9:35742390-35742412 AAGCATGAGCACAGGCATGGAGG - Intronic
1053198152 9:36136027-36136049 CCGCCTGAGGAAAGGCAGGGAGG + Intergenic
1053255485 9:36613726-36613748 CAGCTAGAGCAAAGACTGGGAGG + Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1053582926 9:39425791-39425813 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1053847109 9:42250656-42250678 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054104505 9:60984534-60984556 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054261885 9:62875127-62875149 CAGCTTGAACTAAGGGAGGGAGG - Intergenic
1054453088 9:65413636-65413658 CAGCCTGAGCCAGAGCTGGGAGG + Intergenic
1054703220 9:68435016-68435038 CAGCTTGAGCAAAGGCCTGGAGG - Intronic
1054846594 9:69805296-69805318 CAGCATTAGAAAAGGCAAGGAGG - Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055111342 9:72563087-72563109 CAGCATGAGCAAAGGTGTGGAGG + Intronic
1055422217 9:76155884-76155906 CAGCCTGGACAAAGGCAGTGGGG + Intronic
1055493317 9:76828248-76828270 GAGCCTGTGCAAAGGCACTGAGG + Intronic
1055968005 9:81884041-81884063 CAGCCTGAGCCAAGTGAGGAAGG - Intergenic
1055985772 9:82055897-82055919 AAGCCAGAGAACAGGCAGGGTGG + Intergenic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057182138 9:93035957-93035979 CAGGCTGGGCAGAGGCGGGGTGG - Exonic
1057410611 9:94813876-94813898 GAGCCTGAACACAGCCAGGGTGG - Intronic
1057561639 9:96132644-96132666 CAACATGAACAAAGGCATGGAGG - Intergenic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1058003446 9:99890720-99890742 TAGCTTGAGCAAAGGCATAGAGG + Intergenic
1058086737 9:100755798-100755820 CAGCAAGAGCAAAGGCATGGAGG - Intergenic
1058873210 9:109220247-109220269 TAGCATGAGCAAAGGAACGGTGG + Intronic
1058914405 9:109551761-109551783 TAGCATGAGGAATGGCAGGGAGG - Intergenic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059423869 9:114208908-114208930 CAGAGTGAGGAAAGGCTGGGAGG + Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059454455 9:114390726-114390748 CATGCTGAGCAAGGGCAGAGAGG - Intronic
1059687653 9:116652883-116652905 CAGAGTGAGCAAAGGCACAGAGG - Intronic
1059766371 9:117387548-117387570 CAGCCTGTGCAAAGGCCAAGAGG + Intronic
1059982806 9:119791918-119791940 TTGACTGAGCAAAGGCAAGGAGG + Intergenic
1059988923 9:119846362-119846384 CAGCGTGAGCAAAGGCCTGGAGG + Intergenic
1060051719 9:120382968-120382990 CAGCCTGTGCAAAGGCATGGAGG - Intergenic
1060104319 9:120863967-120863989 TAGCCTGAGCAAAGGCTATGAGG + Intronic
1060175303 9:121493232-121493254 CAGTCTGAGTAAAGCCAGGAAGG + Intergenic
1060223505 9:121776537-121776559 CAGCGTGAGCACAGGCCTGGAGG + Intronic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1060602428 9:124887067-124887089 CAGTCTGAGGAAAGGGAGAGAGG + Intronic
1060675499 9:125510688-125510710 CAACCTGGGGGAAGGCAGGGTGG + Intronic
1060733734 9:126053335-126053357 CAGCATGGGCAAAAGCAAGGAGG - Intergenic
1060765436 9:126292178-126292200 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1060770976 9:126332115-126332137 CAGCCTCAACAAAGGCACCGTGG - Intronic
1060775741 9:126372891-126372913 CAACACGAGCAAAGGCAGGGAGG + Intronic
1060786110 9:126452675-126452697 CAGCAAGATCAAAGGCATGGGGG - Intronic
1060795341 9:126509054-126509076 TAGCATGTGCAAAGGTAGGGAGG - Intergenic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1060826972 9:126693191-126693213 CAGTCAGAGCAAGGGCAGCGGGG + Exonic
1060880857 9:127117085-127117107 CAGCACATGCAAAGGCAGGGAGG - Intronic
1060936172 9:127517435-127517457 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1060978835 9:127780836-127780858 CAGCCTGAGCGAAGGCCTGGAGG - Intergenic
1061046634 9:128168785-128168807 CAGCATCAGTAAAGGCACGGAGG - Intronic
1061219411 9:129241696-129241718 CAGCGTCACCAAAGGCAGAGGGG - Intergenic
1061470376 9:130820307-130820329 CAGCCTTTGCAAAGGCATGAAGG - Intronic
1061774041 9:132948774-132948796 CGGCCTAAGCCAAGGTAGGGCGG - Intronic
1061871405 9:133522612-133522634 CAGCCTAGGCCCAGGCAGGGAGG + Intronic
1062071028 9:134555050-134555072 CAGTCTGAGCCCAGCCAGGGTGG + Intergenic
1062264084 9:135678862-135678884 CAGCCTCAGGGAAGGCTGGGCGG - Intergenic
1062338720 9:136084044-136084066 CAGCCTGAGGAAGAGCGGGGAGG + Intronic
1062443453 9:136583702-136583724 CACCCTGGGCAAAGGCCAGGGGG - Intergenic
1062607588 9:137355028-137355050 CTCCCTGAGGAAAGACAGGGAGG - Intronic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1188983788 X:36751697-36751719 CATCCTAAGCAAAGACATGGTGG - Intergenic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1190286356 X:48963950-48963972 CAGCCTGTGCAAAGGCCTTGAGG - Intronic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1190286971 X:48967786-48967808 CAGCCTGAGAAAAGGCTTAGAGG - Intronic
1190301841 X:49061646-49061668 CAGCCTGGGCAAAGGCCCTGAGG + Intronic
1190401095 X:50035644-50035666 TTGCCTGAGCACAGGCATGGAGG + Intronic
1190481932 X:50885744-50885766 CAGCATGAGAAATGGCAGGGAGG + Intergenic
1190707637 X:53043866-53043888 CAGCCTGTACAAAGGCTTGGGGG - Intergenic
1190736707 X:53260273-53260295 CAGCCAGCGCAAAGGCCCGGAGG + Intronic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1190944045 X:55073351-55073373 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
1191683804 X:63868581-63868603 CAGCCTAAGTAAAGGCACAGAGG - Intergenic
1191741786 X:64443934-64443956 CAGCATCAGAAAAGGCAGTGGGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192536023 X:71928546-71928568 TTGCATGAGCAAAGGCAAGGAGG + Intergenic
1192756268 X:74049586-74049608 CAGCTTGAGGACAGGAAGGGCGG - Intergenic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1196432513 X:115641960-115641982 CAGCATGAGCAAAGGCACCTGGG - Intronic
1196505230 X:116434498-116434520 TAGCATGAGCAAAGGCACTGAGG + Intergenic
1197134244 X:123042238-123042260 CAGGCCAAGGAAAGGCAGGGAGG - Intergenic
1197800590 X:130343674-130343696 CAGACTGGGCAATGGGAGGGAGG + Intronic
1197827746 X:130608492-130608514 CAGCCTGAGCAATTGGAAGGAGG - Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198081307 X:133242288-133242310 CAGCAAGAGCAAAGGCTTGGTGG + Intergenic
1198341656 X:135720063-135720085 CTGCCTGCGCAGAGGCAGAGGGG - Intronic
1198346342 X:135763298-135763320 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198348248 X:135780583-135780605 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198350150 X:135797846-135797868 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198352060 X:135815119-135815141 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198353968 X:135832387-135832409 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198355876 X:135849637-135849659 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198357787 X:135866916-135866938 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198359705 X:135884198-135884220 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198366559 X:135945976-135945998 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198475066 X:136988145-136988167 CATCATGAGCAAAGGCACGATGG - Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1199780180 X:151051380-151051402 CAGCATGTGCAAAGGCCTGGAGG + Intergenic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200230832 X:154443171-154443193 CAGGCTGGGCAAGGGCTGGGAGG - Exonic
1200243329 X:154508922-154508944 CAACCTGAGCAAAGGCAGTGTGG + Intronic
1200378434 X:155808939-155808961 GAGGGTGAGCAAAAGCAGGGCGG + Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic