ID: 1122119528

View in Genome Browser
Species Human (GRCh38)
Location 14:99544690-99544712
Sequence CTCGGAGGAGAGATGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122119528_1122119533 -7 Left 1122119528 14:99544690-99544712 CCTTGACCCATCTCTCCTCCGAG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1122119533 14:99544706-99544728 CTCCGAGACCTCGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1122119528_1122119532 -8 Left 1122119528 14:99544690-99544712 CCTTGACCCATCTCTCCTCCGAG 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1122119532 14:99544705-99544727 CCTCCGAGACCTCGCCTCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122119528 Original CRISPR CTCGGAGGAGAGATGGGTCA AGG (reversed) Intronic
902600488 1:17537551-17537573 CTCAGAGGAGGGAGAGGTCAGGG + Intergenic
904355068 1:29933559-29933581 CAGGGAGCAGGGATGGGTCAGGG + Intergenic
904626832 1:31811015-31811037 CTTGGAGGAGAGATGGGAGGGGG - Intronic
904975449 1:34452565-34452587 CTCTGGGGAGAAATGGGTGAGGG + Intergenic
905688586 1:39926504-39926526 TGTGGAGGAGAGATGGGGCAGGG - Intergenic
906515631 1:46437330-46437352 CTCGGAGGAGAGATTGTGCTGGG - Intergenic
908137999 1:61152875-61152897 CTCTGAGGAGAGAGAGGGCAGGG + Intronic
908930534 1:69312229-69312251 CAGTGAGGACAGATGGGTCAGGG + Intergenic
913481772 1:119295657-119295679 GTCACAGGAGAGATGGGTCCAGG - Intergenic
914404615 1:147358377-147358399 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
915527859 1:156487204-156487226 CTGGGACGAGAGAGGGATCAGGG + Intronic
917131738 1:171750500-171750522 CTGGGAAGAGAAATAGGTCAGGG - Intergenic
917274305 1:173314987-173315009 CTCAAAGGAGAGAGAGGTCAAGG + Intergenic
917845140 1:179014481-179014503 CTGGGAGGAGCCATGGGTTATGG - Intergenic
917930282 1:179818034-179818056 CAGGGAGAAGAGCTGGGTCAGGG - Intergenic
917964902 1:180172309-180172331 CTCGGAGGAGACATTGGCCTGGG + Intronic
918156230 1:181849505-181849527 CACTGAGGAAGGATGGGTCAGGG - Intergenic
918839241 1:189513284-189513306 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
920691935 1:208153909-208153931 CTGGGAGGGGAGATGGGAAAAGG - Intronic
920887026 1:209938632-209938654 CTGGGAGGAGCGAGGGGCCACGG + Intronic
921076332 1:211702905-211702927 CTCGGAGGACAGCTGTGTCCAGG + Intergenic
921736405 1:218633520-218633542 CACTGAGGAAGGATGGGTCAGGG + Intergenic
924629562 1:245724163-245724185 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1063455277 10:6178499-6178521 CTCAGAGGGGACTTGGGTCAGGG + Intronic
1063517635 10:6712285-6712307 CTAGGAGGAGAGGGGGGTCCAGG + Intergenic
1064853784 10:19741539-19741561 CTAGGAGGATAGATGGGCAATGG - Intronic
1064905348 10:20339780-20339802 CTGGGAAGAGCAATGGGTCAGGG - Intergenic
1069090392 10:64193422-64193444 CTGGGAAAAGTGATGGGTCATGG - Intergenic
1069749053 10:70734139-70734161 CGGGGAGGCGAGATGAGTCACGG - Intronic
1069901409 10:71708609-71708631 CTCGGAGGTGAGATGGGCTGAGG - Intronic
1071134566 10:82438281-82438303 CACTGAGGAAGGATGGGTCAGGG + Intronic
1072037266 10:91574972-91574994 CACGGAGGAGTGATGGGACTGGG - Intergenic
1072402719 10:95122016-95122038 CACTGAGGAGGGATGGGTCAGGG + Intergenic
1072814210 10:98488909-98488931 CTCTGAGGAGAGGGGGGGCAGGG - Intronic
1073002359 10:100295073-100295095 CGTGGAGGAGAGCTGGGTCATGG + Exonic
1073566986 10:104543436-104543458 CTTGGAGGAGAGAAAGGTCAGGG - Intergenic
1074003357 10:109393874-109393896 CACTGAGGAAGGATGGGTCAGGG - Intergenic
1075531560 10:123234512-123234534 ATTGGAGGAGAGATGATTCATGG + Intergenic
1076516867 10:131050631-131050653 ATAGGAGGAGAGAAAGGTCAGGG - Intergenic
1076602564 10:131668289-131668311 CTAGGAACAGAGATGGGCCAGGG + Intergenic
1076700899 10:132272109-132272131 CTCGGAGGCACGAGGGGTCAGGG - Intronic
1077538098 11:3134036-3134058 CTCGGAGGAGGGAAGGGTGCAGG + Intronic
1077549472 11:3193650-3193672 CTCAGAGGGGACAGGGGTCAAGG + Intergenic
1078421412 11:11216048-11216070 CTCAGAGTAGGGATGGGCCAGGG - Intergenic
1078642292 11:13108031-13108053 CTAAGAGAAGAGATGGGCCAAGG - Intergenic
1079426062 11:20343086-20343108 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1079935253 11:26608675-26608697 CAGTGAGGAGGGATGGGTCAGGG + Intronic
1080271018 11:30450856-30450878 CTCAGAGGAGATCTGGCTCAGGG + Intronic
1084149861 11:67283046-67283068 CTCAGGGGAGAGAGGGGTCCAGG - Intronic
1086513838 11:87589358-87589380 CACTGAGGAAGGATGGGTCAGGG - Intergenic
1086771680 11:90774883-90774905 CACTGAGGAAAGATGTGTCAGGG + Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088988120 11:114927938-114927960 AACGGAAGAGAGATGGGGCAGGG + Intergenic
1089128079 11:116191352-116191374 CTGGGAGGAGACAGGGCTCAGGG + Intergenic
1091695898 12:2627861-2627883 CTCCTAGGACACATGGGTCACGG - Intronic
1092777880 12:11959913-11959935 TTCCAAGCAGAGATGGGTCATGG - Intergenic
1093303304 12:17479526-17479548 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1094399312 12:30044543-30044565 CTTGGACTAGAGATGGGGCAAGG + Intergenic
1097455711 12:59796296-59796318 CACTGAGGAGGGATGGGTCAGGG - Intergenic
1097643117 12:62205559-62205581 CAGTGAGGAGGGATGGGTCAGGG + Intronic
1098201833 12:68064219-68064241 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1099793262 12:87363406-87363428 CACTGAGGAAGGATGGGTCAGGG + Intergenic
1099938170 12:89153071-89153093 CTCTGAGCAGAGATGGGACGCGG + Intergenic
1101187225 12:102292053-102292075 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1102443730 12:112985248-112985270 CTAGGAGAAGAGATGGGCAAAGG - Intronic
1104644716 12:130488744-130488766 GGAGGATGAGAGATGGGTCAGGG + Intronic
1105355732 13:19657816-19657838 CTCAGTGGTGGGATGGGTCATGG + Intronic
1106861118 13:33909810-33909832 CTCGTAGGAAAGATTGTTCAGGG + Intronic
1106890118 13:34235962-34235984 CACTGAGGAGGAATGGGTCAGGG + Intergenic
1107388869 13:39942567-39942589 CTGTGAGGAGAGATGGGTGCTGG + Intergenic
1107656623 13:42598236-42598258 ATCAGAGGAGAGATGGGGAAGGG - Intronic
1108815638 13:54287046-54287068 CAGTGAGGAGTGATGGGTCAGGG + Intergenic
1108957793 13:56182802-56182824 CAGTGAGGAGGGATGGGTCAAGG - Intergenic
1109097278 13:58134228-58134250 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1109307920 13:60661479-60661501 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1112631094 13:101162046-101162068 CACGGAGGTGTGGTGGGTCAGGG - Intronic
1112759932 13:102683544-102683566 ATCGTATGAGAGAAGGGTCAAGG + Intergenic
1112947946 13:104955329-104955351 CTCTCAGGAGAGATGCTTCAGGG + Intergenic
1113619160 13:111701314-111701336 CTCTGTGGAGAGCTGGGACATGG + Intergenic
1113624689 13:111786575-111786597 CTCTGTGGAGAGCTGGGACATGG + Intergenic
1116428644 14:44820645-44820667 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1118699804 14:68422128-68422150 CTCGAAGGAGACATGGCCCAAGG + Intronic
1119840104 14:77786055-77786077 CGGGGAGGAGAGAGGGGGCAAGG + Intergenic
1120369007 14:83607873-83607895 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1122119528 14:99544690-99544712 CTCGGAGGAGAGATGGGTCAAGG - Intronic
1122768881 14:104088351-104088373 CTCAGAGAAGGGATGGGTCAAGG - Intronic
1124046529 15:26155737-26155759 CAGTGAGGAGGGATGGGTCAAGG + Intergenic
1124196933 15:27639566-27639588 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1125456931 15:39869481-39869503 CTGGGAGGATTGATGGCTCAGGG - Intronic
1125769060 15:42153171-42153193 CTCGGAGGGGAGATGTGCTAGGG - Intronic
1128550756 15:68596606-68596628 CTGGGAGGACAGATAGGTGAAGG + Intronic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1129238190 15:74236359-74236381 GACGGTGGAGAGATGGGGCAGGG - Exonic
1129243789 15:74267839-74267861 CCCGGAGGAGGGATGGGGGAGGG - Intronic
1131508427 15:93035688-93035710 GCCTGAGGAGAGATGGGTCAAGG + Intronic
1134299711 16:12979026-12979048 TTGGGAGGAGAGATGAGTCAAGG - Intronic
1136392420 16:29974016-29974038 CTCGGAAGAGAGAAGGGAGAGGG + Exonic
1137349376 16:47698057-47698079 GTCTGTGGAGAGACGGGTCAGGG - Intronic
1138388503 16:56652778-56652800 CTCTGAGCTCAGATGGGTCAGGG + Intronic
1138491920 16:57382066-57382088 CCCGAAGGAGCAATGGGTCAAGG + Exonic
1140478419 16:75250355-75250377 CTCGGTGGAGAGTTGGGTGGTGG - Intronic
1142415532 16:89939127-89939149 GACGGAGGAGAGAGAGGTCAGGG - Intergenic
1143281310 17:5756624-5756646 CTCTAAGGAGAGGTGGGTTATGG + Intergenic
1143372867 17:6451158-6451180 CTCGGAGCAGAGGTGGATGAGGG - Intronic
1143784446 17:9246138-9246160 ATCGGAGGAAAGATGGATCTTGG + Intergenic
1144132282 17:12258157-12258179 TTTGGAGGACAGATGGGCCACGG + Intergenic
1144653738 17:17022436-17022458 CTCAGAGGACAGATGTGTCTGGG - Intergenic
1144666656 17:17106671-17106693 CTCAGAGGATGGGTGGGTCAGGG + Intronic
1145294347 17:21575920-21575942 CCCAGAGGAGATATGGGTTATGG - Intergenic
1145369484 17:22297260-22297282 CTCAGAGGAGATATGGGTTATGG + Intergenic
1146612617 17:34320838-34320860 CCCCAAGGAGAGATGGGTCAGGG + Exonic
1147142272 17:38466450-38466472 CTCCGAGGAGAGGTGGGGGAAGG - Exonic
1147167651 17:38602004-38602026 CACAGAGGAGAGATGGGGGAGGG + Intronic
1147896226 17:43753172-43753194 CTCAGAGGAGAGAGGGATCATGG + Intergenic
1149062929 17:52445492-52445514 CTCTGAGCAGAGAAGGGTCCTGG - Intergenic
1150190484 17:63232984-63233006 CAGTGAGGAGGGATGGGTCAGGG + Intronic
1151560220 17:74865966-74865988 CTCGGGGGAGAGCTGGGTCCAGG - Intronic
1151561582 17:74872779-74872801 GTCGGAGCAGAGCTGGGGCAGGG - Intronic
1151698649 17:75731048-75731070 CACGGTGGAGAAATGGGTCTGGG + Intronic
1151969239 17:77449437-77449459 CTTGGAGGAGAGCAGGGTCTTGG + Intronic
1153798066 18:8642994-8643016 CTCAGAGTAGAGAGAGGTCAGGG + Intergenic
1153981652 18:10315503-10315525 CTCAGAGCAGAGATGGATGAAGG - Intergenic
1155117508 18:22783992-22784014 CAGTGAGGAGCGATGGGTCAGGG + Intergenic
1156242325 18:35266454-35266476 CTTGGAAGAGAGAGGGGTCAAGG + Intronic
1158676979 18:59529198-59529220 CGGTGAGGAGAGATGGGTCAGGG + Intronic
1159098761 18:63936494-63936516 CTTCGGGGAGAGAAGGGTCAAGG - Intergenic
1159704957 18:71675030-71675052 CTGGGAGGGGAGAGAGGTCAGGG + Intergenic
1159726568 18:71967800-71967822 CTTGGAGAAGAGATTGGCCAGGG + Intergenic
1160744276 19:703563-703585 CCCGGAGGCGACATGGCTCAGGG + Intergenic
1161222895 19:3126176-3126198 CTGGGAGGACAGACGGGTGAGGG + Intergenic
1161243329 19:3235054-3235076 CGAGGAGGAGAGAGGGGGCAGGG - Intronic
1161550183 19:4908563-4908585 CTCCAAGGACAGATGGGTCTAGG - Intronic
1162182514 19:8879846-8879868 CACTGAGGAAGGATGGGTCAGGG - Intronic
1163270665 19:16251562-16251584 CCAAGAAGAGAGATGGGTCATGG - Intergenic
1163949660 19:20571892-20571914 CAGTGAGGAGAGATGGGTCAGGG + Intronic
1165435567 19:35792968-35792990 CTCGAGGGAGAGATGCCTCAGGG + Intergenic
1165583834 19:36894844-36894866 CTAGGAGAAGAGATGGGCAAAGG + Intronic
1166366768 19:42281785-42281807 CACGGAGGAGAGATGGGAAGAGG - Intronic
1166904934 19:46101453-46101475 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1167699065 19:51031773-51031795 CTCAGAGGAAGGATGGGTAAAGG - Intronic
1168412598 19:56149022-56149044 GTCGGAGGAGTGATGGGGGATGG - Intronic
1168412646 19:56149241-56149263 GTCGGAGGAGTGATGGGGGATGG - Intronic
1168564404 19:57411429-57411451 CTCGGAGGAGGGATCGGGCGGGG - Intronic
925670932 2:6309256-6309278 CAGGCAGGTGAGATGGGTCAAGG - Intergenic
927287593 2:21372544-21372566 CCCAGAGGAGAGATGGATCTTGG - Intergenic
927844481 2:26464355-26464377 CTGGGCTGAGAGAAGGGTCAGGG + Intronic
928318045 2:30260869-30260891 CCCGGAGGAGGGCTGGGTGAAGG - Intronic
930730551 2:54724219-54724241 CTCGGTGAAGAGAAGGTTCACGG + Intronic
932486146 2:72085443-72085465 CTCTGAGCAGAGGTGGGTCTGGG - Intergenic
932874208 2:75433446-75433468 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
934810904 2:97275930-97275952 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
934826788 2:97432009-97432031 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
935024349 2:99262002-99262024 CTCGGTGGAGATATGGAGCATGG - Intronic
935055773 2:99565302-99565324 CACGGAGGACAGAGGGGGCAGGG + Intronic
938910659 2:135882680-135882702 CTTGAAGGAGAGAGGGGTTAAGG + Intergenic
945047991 2:205798750-205798772 CTCGGAGAAGAGTTTGGCCAGGG - Intergenic
947872692 2:233448345-233448367 CTCGGAGGAGTCAGAGGTCATGG + Exonic
948876743 2:240833388-240833410 CCAGGAGGAGAGCTGGGTCCAGG + Intergenic
1173534331 20:43797916-43797938 CCCAGAGGAGTGATGGGTAAAGG - Intergenic
1173577794 20:44124208-44124230 CTGGGAGGAGAGATGGGGAAAGG - Intronic
1174188323 20:48722641-48722663 CTCTGAGGAGAGATGGGCCCTGG - Intronic
1174973560 20:55305640-55305662 CAGTGAGGAGAGATGGGTCAGGG - Intergenic
1175831635 20:61967770-61967792 CAGGGAGGAGGGATGGGTGAAGG - Intronic
1178859650 21:36278176-36278198 GTGGGAAGAGAGAAGGGTCAAGG - Intronic
1179041922 21:37811021-37811043 CCCGGAGGATGGATGGGTTAGGG - Intronic
1179049838 21:37879800-37879822 TTGGGAGGAGAGATGGTTCCAGG + Intronic
1181577600 22:23805233-23805255 GTGGGAGGAGACATGGGTGAGGG + Intronic
1182938926 22:34255170-34255192 CACTGAGGAAATATGGGTCAGGG + Intergenic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183716394 22:39535780-39535802 CTGGGAGGAGACATAGGGCATGG - Intergenic
1184235059 22:43178961-43178983 GAAGGAGGAGAGATGGGTCAGGG + Intronic
1185340889 22:50290600-50290622 GTGGGAAGAGAGAAGGGTCAGGG + Intronic
949119930 3:373335-373357 CAAGGAGGAATGATGGGTCAGGG + Intronic
950486864 3:13278989-13279011 CTCGTAGGAGTGATGAGACAAGG + Intergenic
951137248 3:19118341-19118363 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
952305050 3:32138118-32138140 ATGGGAGGAGAGACAGGTCAAGG - Intronic
952572296 3:34731926-34731948 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
952634020 3:35505511-35505533 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
953441808 3:42924812-42924834 CTGGGAGGAGAGTGGGGTCGGGG + Intronic
953663718 3:44910094-44910116 CTCTGAGGAGAGGCAGGTCATGG + Exonic
954816426 3:53285056-53285078 CTTGGAGGAGAGGTGTGTCTGGG - Exonic
955203829 3:56876945-56876967 GTCGGAAGAGAGAAGGGCCAGGG + Intronic
955426473 3:58796198-58796220 GGAGGAGGAGTGATGGGTCAGGG + Intronic
955832118 3:63015612-63015634 CGCTGAGGAAGGATGGGTCAGGG + Intergenic
956264361 3:67380408-67380430 CTGGGAGGAGAGAAGGGTTGTGG - Intronic
957291349 3:78281692-78281714 CACTGAGGAAGGATGGGTCAGGG - Intergenic
960565337 3:119126285-119126307 CACTGAGGAAGGATGGGTCAGGG - Intronic
962709021 3:138070134-138070156 CTCAGAGGAGGGAGGGGACAGGG - Intronic
963785955 3:149534672-149534694 GTTGGAGGAGGGTTGGGTCAGGG - Intronic
964295159 3:155225402-155225424 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
965263341 3:166510863-166510885 CACTGAGGAAGGATGGGTCAAGG - Intergenic
966250504 3:177860178-177860200 CAATGAGGAGGGATGGGTCAGGG + Intergenic
966736291 3:183189621-183189643 CTGGAAGGAGAAATGGGTCCTGG + Intronic
969855569 4:9996484-9996506 GTGGGAGGAGGGAGGGGTCAGGG + Intronic
970414007 4:15838571-15838593 CCTGGAGGAGAGGAGGGTCAAGG - Intronic
971903267 4:32691703-32691725 CTGAGTGGAGAGATGAGTCAGGG - Intergenic
972038993 4:34566488-34566510 GTGGGAGGAAAGATGGGTGATGG - Intergenic
973878638 4:55246731-55246753 CTGGGAGTTGAGATGAGTCAGGG - Intergenic
974499702 4:62684251-62684273 CAGTGAGGAGAGATGGCTCAGGG - Intergenic
976375673 4:84342559-84342581 CATTGAGGAGGGATGGGTCAGGG - Intergenic
976538202 4:86242578-86242600 CACTGAGGAAGGATGGGTCAGGG + Intronic
976807421 4:89063508-89063530 CACTGAGGAAGGATGGGTCAGGG + Intronic
979250719 4:118564246-118564268 CTGCGAGGAGAGATGTGGCAGGG + Intergenic
980392920 4:132169617-132169639 CACTGAGGAAAGATGGGTCAGGG + Intergenic
984092117 4:175387473-175387495 CTGTGAGGAAGGATGGGTCAGGG - Intergenic
984215757 4:176911061-176911083 CACTGAGGAAGGATGGGTCAGGG - Intergenic
984626105 4:182009458-182009480 CACTGAGGAAGGATGGGTCAGGG + Intergenic
985865218 5:2509232-2509254 TCGGGAGGAGAGAAGGGTCATGG - Intergenic
986756111 5:10838223-10838245 CGCGGAGCAGAGATGAGTCATGG + Intergenic
987834694 5:23146170-23146192 CACTGAGGAAGGATGGGTCAGGG + Intergenic
987988568 5:25181175-25181197 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
988059508 5:26148967-26148989 CACTGAGGAAGGATGGGTCAGGG - Intergenic
988786052 5:34566209-34566231 CTGGAAGGTGAGATGGGTCTGGG - Intergenic
989276802 5:39598931-39598953 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
992569329 5:78038728-78038750 CCAGGAGGAGAGATGGGGAAAGG + Intronic
994350688 5:98742710-98742732 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
995121119 5:108536144-108536166 CTCAGAGAAGAGTTGGGCCAGGG + Intergenic
995927082 5:117386942-117386964 CTAGAAGGAGAGAAGAGTCATGG + Intergenic
996893839 5:128456208-128456230 CACTGAGGAAGGATGGGTCAGGG - Intronic
997322224 5:132987991-132988013 CTCGGGAGAGAGATGGGAGAAGG - Intergenic
997673429 5:135695001-135695023 CCAGGAGGAGAGGTGGGTGATGG - Intergenic
998605937 5:143634589-143634611 CTTGGAGGAGAGAAGAGTTAGGG + Intergenic
999138980 5:149344902-149344924 CTGGGAGGAGTGATGGGCAATGG + Intergenic
999145451 5:149390234-149390256 CCCTGGGGAAAGATGGGTCAGGG + Intronic
1000057007 5:157615965-157615987 CTAGGAGAAGACATGGATCATGG + Intergenic
1001839697 5:174864707-174864729 CACTGAGGAAGGATGGGTCAGGG + Intergenic
1001854081 5:174995623-174995645 CAGGGAGGAGAGAGGGGTGAGGG + Intergenic
1005627865 6:27680414-27680436 CTGTGAGGAGAGAAGGGTAAAGG - Intergenic
1006257645 6:32844182-32844204 GTCGGGGGAATGATGGGTCAAGG + Intronic
1007485450 6:42178090-42178112 CTAGGAAGACAGATAGGTCACGG + Intronic
1007666762 6:43518397-43518419 CTGAGAGGAGAAATGGGTCTGGG + Intronic
1008741572 6:54615181-54615203 CACTGAGGAAGGATGGGTCAGGG - Intergenic
1008773648 6:55009123-55009145 CACTGAGGAAGGATGGGTCAAGG + Intergenic
1008834397 6:55808212-55808234 CAGTGAGGAGGGATGGGTCAAGG + Intronic
1009970744 6:70623228-70623250 CTGGGAGGAGGGAAGGGGCAGGG + Intergenic
1013346103 6:109262244-109262266 CTCGGAAGAGAGAAGGAACAAGG - Intergenic
1014484746 6:121984960-121984982 CAGTGAGGAGTGATGGGTCAGGG + Intergenic
1015270213 6:131330203-131330225 CTAAGAGGAGGGGTGGGTCAGGG + Intergenic
1015660172 6:135566306-135566328 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1017043310 6:150324903-150324925 CTGGGAGGACAGCTGGGTGATGG + Intergenic
1017599601 6:156066358-156066380 CCCGGGAGAGATATGGGTCAAGG - Intergenic
1017775684 6:157679253-157679275 CACGGAGGAGAGAAGGGGCTGGG - Intergenic
1017775740 6:157679441-157679463 CATGGAGGAGAGAAGGGTCTGGG - Intergenic
1019856462 7:3613274-3613296 CTCTGCAGATAGATGGGTCATGG + Intronic
1019862434 7:3672113-3672135 CTCTGAGGAGTGGCGGGTCATGG + Intronic
1022690907 7:32652307-32652329 CTCAGGGGAGAGATGGGTAATGG + Intergenic
1028644148 7:93076771-93076793 CAGTGAGGAGATATGGGTCAGGG - Intergenic
1028967410 7:96817492-96817514 CCAAGAGGAGAGATGGATCAGGG + Intergenic
1029221273 7:98992338-98992360 CACTGAGGAGAGATTGGCCACGG - Intronic
1031362898 7:120868218-120868240 CTAGGAGCTGAGATGAGTCAGGG - Intergenic
1034520290 7:151614271-151614293 CTCGCAGGGGACATGGGGCAGGG + Intronic
1034855921 7:154547213-154547235 CTCAGATTAGAGATGGCTCATGG - Intronic
1035599549 8:889522-889544 CACTGAGGAAGGATGGGTCAGGG + Intergenic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1036555452 8:9855734-9855756 CTGGGAGGAGAGAGGGGTCTGGG + Intergenic
1037249580 8:16877032-16877054 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1037832436 8:22197442-22197464 CTCCGAGGAGAGGTGGGGCTAGG - Intronic
1038073700 8:24046480-24046502 CACTGAAGAGGGATGGGTCAGGG - Intergenic
1039025389 8:33252750-33252772 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1039265158 8:35816105-35816127 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1040762991 8:50873808-50873830 CAGTGAGGAGGGATGGGTCAAGG + Intergenic
1041785874 8:61633268-61633290 CTCTCAGGAGAGATGGGGAATGG + Intronic
1042759670 8:72257240-72257262 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1043233331 8:77830329-77830351 CTGTGAGGAGGGATGGGCCAGGG - Intergenic
1045037495 8:98187113-98187135 CTTGGAGGAGAGAAAGGTCTAGG - Intergenic
1052617527 9:30860812-30860834 CTGGGTGGATAGATGGGTGATGG + Intergenic
1052716967 9:32128911-32128933 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1055818866 9:80238479-80238501 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1057241654 9:93416891-93416913 CAGTGAGGAGAGATGGGTCAGGG + Intergenic
1058893566 9:109381479-109381501 CTCAGAGGTGAGATGGGTGTGGG + Intronic
1058978466 9:110146770-110146792 CTAGGAGGTGAGGTGGGGCAGGG + Intronic
1059746204 9:117204087-117204109 CACTGAGGAAGGATGGGTCAGGG + Intronic
1060321112 9:122562069-122562091 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1060549946 9:124480191-124480213 CTCCTGGGAGAGATGGGTCTGGG - Intergenic
1061288095 9:129635676-129635698 CTCGCAGGAGAGCAGGGTCTGGG - Exonic
1062344600 9:136109094-136109116 CGGGGAGGGGAGAGGGGTCAGGG - Intergenic
1185649372 X:1637498-1637520 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649401 X:1637663-1637685 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649430 X:1637828-1637850 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649445 X:1637911-1637933 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649474 X:1638076-1638098 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649489 X:1638159-1638181 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649518 X:1638324-1638346 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649547 X:1638489-1638511 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649562 X:1638572-1638594 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649606 X:1638817-1638839 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649635 X:1638982-1639004 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649664 X:1639147-1639169 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649693 X:1639312-1639334 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649750 X:1639640-1639662 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649779 X:1639805-1639827 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649808 X:1639970-1639992 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649837 X:1640135-1640157 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649868 X:1640300-1640322 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649898 X:1640465-1640487 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649927 X:1640628-1640650 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649956 X:1640793-1640815 CTCACAGGAGAGCTGGGACATGG - Intronic
1185649985 X:1640958-1640980 CTCACAGGAGAGCTGGGACATGG - Intronic
1185650016 X:1641123-1641145 CTCACAGGAGAGCTGGGACATGG - Intronic
1185650046 X:1641288-1641310 CTCACAGGAGAGCTGGGACATGG - Intronic
1186767723 X:12788908-12788930 CATGGAGGAGAGAAGGGCCAGGG + Intergenic
1187367056 X:18674596-18674618 CTGGGAGGAGAGGTGGGGTAGGG + Intergenic
1189694307 X:43647976-43647998 CTAGGAGGATTGCTGGGTCAAGG + Intergenic
1191900813 X:66039215-66039237 CTTGGAGGAGAGAAGAGTCAAGG + Intronic
1192282275 X:69699443-69699465 CTTGGAGGAGGCATGGGGCAGGG + Intronic
1193605904 X:83567415-83567437 CCCGGGGGAGGGATGGGTCAGGG + Intergenic
1194235025 X:91372459-91372481 CTCGGAATAGAGAAGGGTCGAGG + Intergenic
1196206751 X:112948504-112948526 CTCAGTGGAGAGATGGACCAAGG + Intergenic
1196381792 X:115098850-115098872 CGGTGAGGAGGGATGGGTCAGGG - Intergenic
1196599895 X:117589897-117589919 GTTTGAGGAGGGATGGGTCAGGG - Intergenic
1197046475 X:122004073-122004095 CACTGAGGAAGGATGGGTCAGGG + Intergenic
1197049551 X:122042416-122042438 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1198841355 X:140861115-140861137 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1199861427 X:151803434-151803456 CTCGGGGGAGGGTTGGGGCAGGG + Intergenic
1201299086 Y:12490522-12490544 CTCAGAGGGGAGATGTCTCATGG - Intergenic
1201511476 Y:14769434-14769456 CTGGGAAGAGAAAGGGGTCAGGG + Intronic