ID: 1122120499

View in Genome Browser
Species Human (GRCh38)
Location 14:99550908-99550930
Sequence GTCCAGCTCGACCAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122120495_1122120499 0 Left 1122120495 14:99550885-99550907 CCAATATACGACTGCTCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 68
1122120494_1122120499 3 Left 1122120494 14:99550882-99550904 CCTCCAATATACGACTGCTCACC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 68
1122120490_1122120499 25 Left 1122120490 14:99550860-99550882 CCTGGGGTGCCCAGGCCACACTC 0: 1
1: 0
2: 3
3: 65
4: 364
Right 1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 68
1122120491_1122120499 16 Left 1122120491 14:99550869-99550891 CCCAGGCCACACTCCTCCAATAT 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 68
1122120493_1122120499 10 Left 1122120493 14:99550875-99550897 CCACACTCCTCCAATATACGACT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 68
1122120492_1122120499 15 Left 1122120492 14:99550870-99550892 CCAGGCCACACTCCTCCAATATA 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122120499 Original CRISPR GTCCAGCTCGACCAAGCTGC TGG Intronic
900518645 1:3095249-3095271 GGCCACCTCAACCCAGCTGCAGG - Intronic
903058917 1:20655880-20655902 GCCCAGCTGGATGAAGCTGCAGG - Intronic
903287649 1:22286698-22286720 GTCCAGCTCAACCCACCAGCAGG - Intergenic
906106809 1:43299670-43299692 AACCAGCTCAACCAAGCTGCAGG + Intergenic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
922865541 1:228858450-228858472 GTCCACCTGGTCCTAGCTGCAGG + Intergenic
1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG + Intronic
1074377913 10:112953321-112953343 GGCCAGTTCCACCAGGCTGCAGG + Intronic
1075710528 10:124528224-124528246 GTCCTGCTAGACCAGGCTGGTGG + Intronic
1076713380 10:132351205-132351227 GTCCAGCCCGGGCGAGCTGCTGG + Intronic
1081629894 11:44681829-44681851 GCCCAGCTGGCCCTAGCTGCAGG - Intergenic
1083600585 11:63945154-63945176 GGCCAGCAAGACGAAGCTGCAGG - Intronic
1084036743 11:66515912-66515934 GTCCAACTCCATCAAGCGGCAGG + Exonic
1088462011 11:110092704-110092726 GTCGGGCTCGACCCAGCCGCTGG - Intergenic
1088655494 11:111995411-111995433 GAGCATCTCGAACAAGCTGCAGG - Intronic
1092899379 12:13044418-13044440 GTCCAGGGCGCTCAAGCTGCCGG + Exonic
1096228097 12:49882155-49882177 GTCCAGCTCTGCTCAGCTGCAGG + Intronic
1103614012 12:122141006-122141028 GTGCAGCTCCTCCAGGCTGCTGG - Exonic
1107672565 13:42761186-42761208 GTCCAGCCCGCCCAAGATGTGGG + Intergenic
1111596708 13:90420874-90420896 CTCCAGCTCCACCTATCTGCGGG - Intergenic
1113086432 13:106574004-106574026 GTCCAGTCCGAGCAAGTTGCTGG - Intergenic
1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1114535540 14:23419959-23419981 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1121867192 14:97373500-97373522 GTCCAGCTGAAGCAAGCTGAGGG + Intergenic
1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG + Intronic
1131261456 15:90890155-90890177 GTGCAGCCAGGCCAAGCTGCAGG + Exonic
1134909326 16:18009803-18009825 GTCCAGCTCCAGGAACCTGCTGG + Intergenic
1135853802 16:25988109-25988131 GACCAGCATGACCAGGCTGCCGG + Intronic
1142234095 16:88913264-88913286 GTCCAGCTCCACCAAGTGGCCGG - Intronic
1142550798 17:738071-738093 ACCCAGCTCAACCCAGCTGCTGG - Intronic
1145778350 17:27545043-27545065 GTGCAGCACGACCCAGCTACTGG - Intronic
1147988975 17:44321912-44321934 GTCCGCCTGGACCCAGCTGCTGG - Intronic
1152597601 17:81245623-81245645 GCCCAGCTCCGCCAGGCTGCGGG - Exonic
1153224699 18:2890612-2890634 GTACAGCACAACCAAGCTGGGGG + Exonic
1157524576 18:48371209-48371231 GACAAGCTCTATCAAGCTGCAGG + Intronic
1161295021 19:3515067-3515089 GACCAGGGCAACCAAGCTGCAGG + Intronic
1163211265 19:15842065-15842087 GTCCAGAGAGGCCAAGCTGCTGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166919252 19:46217602-46217624 ACCCACCTCGACCAAACTGCTGG + Intergenic
1168013750 19:53554977-53554999 GCCCAGCACGGCCACGCTGCCGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
927284470 2:21342103-21342125 GTCAAGCTTGCCCAACCTGCAGG - Intergenic
930110566 2:47675385-47675407 GTCCAGCTAGGCTCAGCTGCCGG - Intergenic
933813533 2:86048222-86048244 GGCCAGCTCCTCCAAGCAGCAGG + Intronic
935616098 2:105083391-105083413 GTCCAGGATGACCAAGCTGGTGG + Intronic
937980536 2:127612089-127612111 GTAAAGCTCTACCAAGCTGAGGG + Intronic
1168769630 20:407380-407402 GTCCATTTCCACCTAGCTGCCGG - Intergenic
1176127051 20:63480271-63480293 GGCCAGCTCGTCCGAGCCGCAGG - Intergenic
1178262235 21:31110588-31110610 GCCCACATCGACAAAGCTGCAGG - Intergenic
951553558 3:23898641-23898663 GTCCAGCTTGACCAACATGGTGG - Intronic
965127156 3:164646353-164646375 GTTCAGCTGGACTAAGCTGAAGG - Intergenic
980013645 4:127623443-127623465 GTCCAGGTCCTCCAGGCTGCGGG - Intronic
994684246 5:102929769-102929791 ATCAAGCTTGTCCAAGCTGCAGG + Intronic
997655088 5:135548625-135548647 GGCCAGCTCCAGCAAGGTGCTGG + Intergenic
999366747 5:151028423-151028445 GTCCAGCACTACACAGCTGCAGG - Exonic
1002477324 5:179475331-179475353 ATCCAGCTCAGCCAAGCTGCCGG - Intergenic
1007977669 6:46118096-46118118 GCCCAGCTCACCCAGGCTGCAGG + Intergenic
1018145352 6:160881588-160881610 TTCCAGCTCGACTGAGCTGCTGG + Intergenic
1018421142 6:163641959-163641981 GTCCAGCTCGATGCAGCTGCAGG + Intergenic
1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG + Intronic
1026385192 7:69839859-69839881 CTCCACCTCCACCAAGCTCCTGG - Intronic
1029690562 7:102178570-102178592 GGCCAGCCTCACCAAGCTGCGGG + Exonic
1034211277 7:149365304-149365326 CTCCAGCTGGGCCAACCTGCTGG - Intergenic
1035752475 8:2006000-2006022 ATCCAGCTCTACAAAGCTGCAGG - Exonic
1040385220 8:46910708-46910730 GTCAAGCTTGTCCAACCTGCAGG - Intergenic
1049680676 8:143916618-143916640 GTCGGGCTCGATCAAGCCGCCGG + Exonic
1056459491 9:86795706-86795728 GTCCAGCTGGAAGAATCTGCAGG + Intergenic
1061572797 9:131488034-131488056 GGCCAGCTCAGCCAGGCTGCTGG + Exonic
1062002617 9:134224518-134224540 GTCCAGCTCCACCAAGTTCAGGG - Intergenic
1062511266 9:136907479-136907501 GTGCAGCTAGACCCAGCTCCTGG + Intronic
1198984827 X:142438614-142438636 GACCAGCCTGACCAAGATGCAGG + Intergenic
1200151044 X:153951639-153951661 GGCCAGCCCAGCCAAGCTGCAGG - Exonic
1200697694 Y:6375595-6375617 CTCTATCTCCACCAAGCTGCAGG + Intergenic
1200698856 Y:6385273-6385295 CTCCTTCTCAACCAAGCTGCAGG + Intergenic
1201035256 Y:9779426-9779448 CTCCTTCTCAACCAAGCTGCAGG - Intergenic
1201036418 Y:9789104-9789126 CTCTATCTCCACCAAGCTGCAGG - Intergenic