ID: 1122126292

View in Genome Browser
Species Human (GRCh38)
Location 14:99580345-99580367
Sequence CACTGCACTCACGGTGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122126292_1122126302 -7 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126302 14:99580361-99580383 TGCAGTGGGGGAGGCAGGAGGGG 0: 1
1: 1
2: 14
3: 161
4: 1517
1122126292_1122126304 9 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126304 14:99580377-99580399 GGAGGGGCTTTTGGACACTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
1122126292_1122126303 0 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126303 14:99580368-99580390 GGGGAGGCAGGAGGGGCTTTTGG 0: 1
1: 0
2: 7
3: 76
4: 790
1122126292_1122126301 -8 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126301 14:99580360-99580382 GTGCAGTGGGGGAGGCAGGAGGG 0: 1
1: 3
2: 10
3: 123
4: 1372
1122126292_1122126305 16 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126305 14:99580384-99580406 CTTTTGGACACTGAGGTAGCTGG 0: 1
1: 1
2: 13
3: 288
4: 6370
1122126292_1122126300 -9 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126300 14:99580359-99580381 AGTGCAGTGGGGGAGGCAGGAGG 0: 1
1: 0
2: 9
3: 119
4: 979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122126292 Original CRISPR CACTGCACTCACGGTGACTC TGG (reversed) Intronic
902865766 1:19277595-19277617 CACTGCAATCTCGGTGTCCCAGG + Intergenic
905596672 1:39213623-39213645 CACTGCACTCAGTCTCACTCAGG + Intronic
905945042 1:41894771-41894793 CCCAGCACTGAAGGTGACTCTGG + Intronic
907325276 1:53633977-53633999 CTCTGCACTCACAGTGGATCTGG - Intronic
911049416 1:93657977-93657999 CACTGCACTCCTGGTGACAGAGG - Intronic
911352965 1:96777649-96777671 CACTGCACTCTCGCTAACTGTGG - Exonic
915238328 1:154502019-154502041 CACTGCATTCCCCGTGACTGGGG + Exonic
918796477 1:188904240-188904262 AACTTCACTCAAGGTAACTCTGG + Intergenic
919448423 1:197739241-197739263 CACTGGACTGAAGATGACTCTGG + Intronic
920288352 1:204898131-204898153 CCCAGCACTCTGGGTGACTCAGG - Intronic
922354624 1:224764097-224764119 CACTGCACTCACTCTGCCACAGG - Intergenic
922423794 1:225475967-225475989 CACTGCACTCACTGTCAGCCTGG + Intergenic
923092466 1:230750813-230750835 GAGTGCACTGAGGGTGACTCAGG + Intronic
1062916016 10:1241764-1241786 CACTGCACTCACGTTCTCTGAGG + Intronic
1066339077 10:34511848-34511870 GACTGCACTCGCTGTGGCTCGGG - Intronic
1070236220 10:74629287-74629309 CCCTGCAATCCCAGTGACTCAGG - Intronic
1076767500 10:132644553-132644575 CACGGCACTCACTGTGAGCCAGG - Intronic
1078286753 11:9964122-9964144 CACTGTAATCCCAGTGACTCGGG + Intronic
1083597401 11:63924806-63924828 GCCTGTAATCACGGTGACTCAGG - Intergenic
1084734190 11:71093935-71093957 CACTGCAGCCACGGCGCCTCTGG - Intronic
1085668544 11:78439325-78439347 CACCGCACCCACGGTGGCTTTGG + Intronic
1087893863 11:103565827-103565849 CACTACAGTCACTGTGACTGTGG + Intergenic
1089425290 11:118368910-118368932 CACTGCACTCCCTGGAACTCAGG + Intronic
1095482484 12:42650460-42650482 CACTGCACTCCTGGTGACAAAGG - Intergenic
1099702641 12:86106976-86106998 CTCTTCATTCATGGTGACTCAGG - Intronic
1101736977 12:107470535-107470557 CACTGCCCACACCGTGACCCTGG - Intronic
1102014221 12:109637258-109637280 CACTGCAGCCACGGTCACACTGG + Intergenic
1104891375 12:132141770-132141792 CTCTGCTCCCACGGTGCCTCAGG + Intronic
1105426804 13:20301633-20301655 CACCGCATTCACGGCGATTCAGG - Intergenic
1118687493 14:68305719-68305741 CACTGCAGACACAGTGAGTCAGG - Intronic
1119388344 14:74273086-74273108 CACTGCACTCCAGGTGACAGAGG - Intergenic
1122010614 14:98743527-98743549 AACTGCACCCATGGTGAGTCGGG + Intergenic
1122018624 14:98818434-98818456 CCCTCTACTCACTGTGACTCAGG - Intergenic
1122126292 14:99580345-99580367 CACTGCACTCACGGTGACTCTGG - Intronic
1123112810 14:105881045-105881067 CACTATACCCACCGTGACTCGGG + Intergenic
1124648251 15:31455728-31455750 CACTGCCATCACTGTGACTGTGG - Intergenic
1125368552 15:38945584-38945606 CACTGTACTCACTGAGACACAGG + Intergenic
1126665285 15:51070612-51070634 CACTGAACTCAGGCAGACTCTGG - Intronic
1130391828 15:83463315-83463337 CAATGAACTGACGCTGACTCTGG + Intronic
1130964214 15:88685292-88685314 TGCTGCACACAGGGTGACTCTGG + Intergenic
1132704567 16:1237518-1237540 CTCTGCCCTCAGGGTGACTCGGG - Intergenic
1132706946 16:1248907-1248929 CTCTGCCCTCAGGGTGACTCGGG + Intergenic
1138828840 16:60354330-60354352 CTCTGCAGTCACAGTGACTTGGG - Intergenic
1141684261 16:85561498-85561520 CACTGAACTCTGGGTGACCCTGG + Intergenic
1141932769 16:87216959-87216981 CACTTCACCGGCGGTGACTCAGG + Intronic
1143202119 17:5120399-5120421 CACAACACACACTGTGACTCGGG - Intronic
1144711963 17:17407108-17407130 CACAGCACCCAGGGTGACACTGG - Intergenic
1147799795 17:43076052-43076074 CACTGCAATCTAGGTGACACAGG + Intronic
1152052815 17:77995276-77995298 CCCTGCACACACAGTGCCTCTGG - Intergenic
1152730090 17:81965899-81965921 CACTCCGCTCACGGGGCCTCAGG - Intergenic
1153256798 18:3179812-3179834 CACTGGACTCAAGCTCACTCTGG + Intronic
1153582953 18:6593857-6593879 CTCTGTACTCACACTGACTCTGG - Intergenic
1154095744 18:11413588-11413610 CACTGCACTCACAGGGAGACAGG - Intergenic
1154387835 18:13911608-13911630 CGCTGCACTCATGGTGGCCCTGG - Intronic
1160227975 18:77025965-77025987 CGATGCACTCACGGTGCCGCAGG - Intronic
1162484030 19:10947632-10947654 CACTGCAACCACTGTGTCTCAGG - Intergenic
925155801 2:1648323-1648345 CATGGCACACACGGTGGCTCTGG - Exonic
926897614 2:17711655-17711677 CACTGCACTCCAGGTGACAGAGG - Intronic
932618755 2:73253239-73253261 CACTGCTCTCAGGGTTTCTCTGG + Intergenic
933463647 2:82622104-82622126 CAGTGCTCACACTGTGACTCTGG - Intergenic
937936509 2:127249598-127249620 CACTGCACTCACAGTACATCAGG + Intergenic
938763735 2:134446721-134446743 CAGTGCTCTCCCGGTGACTGTGG + Intronic
938958597 2:136320889-136320911 CACTGCACTCCCAGCTACTCGGG - Intergenic
943190915 2:184679516-184679538 CTCTGCACTCCCGGGGGCTCAGG + Intronic
947000092 2:225444313-225444335 CACTGTACTCAGGGTGAGTGTGG - Intronic
1168948776 20:1782355-1782377 CACTTCCCTCACTGTGGCTCAGG - Intergenic
1169482222 20:5994637-5994659 CACTGTAATCACAGTGACTCAGG + Exonic
1169488531 20:6052945-6052967 CACTGCACACTAGGCGACTCTGG - Intronic
1170493048 20:16898020-16898042 CATTGCACTCAAGGTGACCTGGG + Intergenic
1173031384 20:39364385-39364407 AACTGCAATGACGGGGACTCTGG + Intergenic
1175882662 20:62269901-62269923 CACTGGACACACGGGGACTGTGG - Intronic
1180929445 22:19579043-19579065 CACTGCTCTCACTGAGCCTCGGG + Intergenic
1182868634 22:33626915-33626937 CCCTGAACTCAGGGTGACCCTGG + Intronic
1183209158 22:36439922-36439944 CACTGCAGACAGGGTGAGTCAGG - Intergenic
1184165911 22:42727632-42727654 CACAGCAGTCACTGTGACACTGG - Intergenic
1184471151 22:44697227-44697249 CAGGGTACTCGCGGTGACTCCGG - Intronic
955099084 3:55829552-55829574 CACTGCACTCTAGGTGACAGAGG - Intronic
959099620 3:101995670-101995692 CTCTCCACTAACAGTGACTCTGG - Intergenic
959648439 3:108728356-108728378 CACTGAACTCAGAGTGCCTCAGG + Intergenic
960574752 3:119218595-119218617 CTCTGCACTCAGTGTGGCTCTGG - Intronic
962264624 3:133936016-133936038 CATAGGACTCACAGTGACTCTGG + Intronic
964968310 3:162526737-162526759 CACTGCACTCCAGGTGACAGAGG - Intergenic
967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG + Intronic
969226647 4:5803002-5803024 CACTGGACTCATGGTCACTGCGG - Intronic
969465030 4:7351176-7351198 CACTGCGGTGACAGTGACTCAGG - Intronic
973072989 4:45888443-45888465 CACTGCTCCCACTGTGTCTCAGG + Intergenic
974589228 4:63921773-63921795 TCCTGCACCCACCGTGACTCCGG + Intergenic
985174506 4:187187180-187187202 GACTGCAATCACGCTGACCCTGG - Intergenic
985526684 5:406767-406789 CACTGCAGTCACGGTGATCCAGG + Intronic
987785562 5:22494186-22494208 AACTGCACAGACGGTGACCCTGG - Intronic
988835538 5:35028809-35028831 CACTGCTTTCACTGTCACTCGGG - Intronic
989339070 5:40354237-40354259 CTCTGCACTCCTGGGGACTCAGG + Intergenic
989662914 5:43818654-43818676 CACTGCAATCTCTGTGTCTCGGG + Intergenic
997554444 5:134783318-134783340 CACTGCGCTCACTGTGACCTCGG + Intronic
997879012 5:137573415-137573437 CTGTGGACTCACTGTGACTCTGG - Intronic
998723299 5:144978242-144978264 CTCTGCAATCACAGTGACTATGG + Intergenic
1002526598 5:179818990-179819012 CAGGGGACTCACGGTGACCCCGG + Intronic
1005714139 6:28531128-28531150 CACTCCACTCAGGGTGAGCCAGG + Intronic
1005920530 6:30397160-30397182 CTCTGCACTCAAGGAGCCTCCGG + Intergenic
1006448235 6:34091691-34091713 CACTGGGCTCTGGGTGACTCCGG - Intronic
1006531423 6:34658303-34658325 CACTGCACTCACTCTGACCTAGG + Intronic
1007434947 6:41803794-41803816 CACAGCACTCACTGTTACACTGG + Exonic
1008647080 6:53525822-53525844 CAATGCCCTGAAGGTGACTCTGG + Intronic
1009294120 6:61922581-61922603 CACTGCACTCACAGGGAACCAGG + Intronic
1010104666 6:72152617-72152639 CACAGCACTCATGGAGATTCTGG + Intronic
1015884216 6:137899724-137899746 CACTCCACCCTCGGTGACACAGG + Intergenic
1021097159 7:16547525-16547547 CCCTGCACTCTCGGGGACCCAGG + Intronic
1021964881 7:25907518-25907540 CACTGCAGTGCCTGTGACTCGGG - Intergenic
1022394386 7:29972701-29972723 CAGTGCACACATGGTGATTCAGG - Intronic
1024678542 7:51660075-51660097 CGTTGCTCTCACAGTGACTCAGG - Intergenic
1026413592 7:70154727-70154749 CACTTGACTCATGGTGACTTTGG + Intronic
1028469553 7:91190563-91190585 CACTGCAATCTCTGTGTCTCAGG + Intronic
1030058927 7:105607722-105607744 CTGTGCACTCCCTGTGACTCTGG - Exonic
1034534284 7:151717389-151717411 AACTCCACTCAAGGTGACTGGGG + Intronic
1035018092 7:155783723-155783745 CACTGCACTCCCGGTGACACAGG - Intergenic
1036220670 8:6919562-6919584 CCCTGCGCTCATGGTGGCTCAGG + Intergenic
1039913341 8:41842080-41842102 CACTGCTCTGACTGTGACCCAGG + Intronic
1040865873 8:52048551-52048573 CACTGCACACACGATACCTCAGG + Intergenic
1041223189 8:55671868-55671890 CCCTCCCCTCACTGTGACTCTGG - Intergenic
1042004834 8:64169049-64169071 CTCTGCACTCATGGTGACTTGGG + Intergenic
1042083772 8:65086438-65086460 CACTGCATTGACAGTGACTGAGG - Intergenic
1044749860 8:95405871-95405893 CATGGCTCTCACTGTGACTCTGG - Intergenic
1045379245 8:101606641-101606663 CACTGCAGTCACCATGACCCAGG - Intronic
1049075113 8:140389445-140389467 CACTGCCGTCACGGCCACTCAGG + Intronic
1049538448 8:143194068-143194090 CACTGCAGTCACAGCCACTCAGG + Intergenic
1049805268 8:144536008-144536030 GACTGCACTCACGCTGCCTCAGG + Intronic
1049826944 8:144674980-144675002 CCCTGCTCTCTCGGGGACTCAGG - Intergenic
1051459106 9:17293565-17293587 CACAGCACTCACAGTGGCTATGG - Intronic
1056507476 9:87270881-87270903 CACCGCACTCACAATCACTCAGG - Intergenic
1056779510 9:89538849-89538871 CACTGCACACACTGAGGCTCAGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1060531010 9:124346992-124347014 CTCTGCACTCGCTGTGTCTCTGG - Intronic
1185764302 X:2712304-2712326 TACTGTACTCAGGGTGACTGTGG + Intronic
1189856459 X:45229438-45229460 CTCTGCACTCTCGGGGACCCGGG - Intergenic
1194177858 X:90673535-90673557 CACTGCACTCTGGGTGACAGAGG + Intergenic
1196610874 X:117713317-117713339 CACTGCACTGAAGGAGAGTCTGG - Intergenic
1197294733 X:124705037-124705059 CACTGCAATCACAGTGACTTTGG - Exonic
1200524522 Y:4255685-4255707 CACTGCACTCTGGGTGACAGAGG + Intergenic