ID: 1122126292

View in Genome Browser
Species Human (GRCh38)
Location 14:99580345-99580367
Sequence CACTGCACTCACGGTGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122126292_1122126302 -7 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126302 14:99580361-99580383 TGCAGTGGGGGAGGCAGGAGGGG 0: 1
1: 1
2: 14
3: 161
4: 1517
1122126292_1122126301 -8 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126301 14:99580360-99580382 GTGCAGTGGGGGAGGCAGGAGGG 0: 1
1: 3
2: 10
3: 123
4: 1372
1122126292_1122126300 -9 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126300 14:99580359-99580381 AGTGCAGTGGGGGAGGCAGGAGG 0: 1
1: 0
2: 9
3: 119
4: 979
1122126292_1122126303 0 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126303 14:99580368-99580390 GGGGAGGCAGGAGGGGCTTTTGG 0: 1
1: 0
2: 7
3: 76
4: 790
1122126292_1122126304 9 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126304 14:99580377-99580399 GGAGGGGCTTTTGGACACTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
1122126292_1122126305 16 Left 1122126292 14:99580345-99580367 CCAGAGTCACCGTGAGTGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1122126305 14:99580384-99580406 CTTTTGGACACTGAGGTAGCTGG 0: 1
1: 1
2: 13
3: 288
4: 6370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122126292 Original CRISPR CACTGCACTCACGGTGACTC TGG (reversed) Intronic