ID: 1122127014

View in Genome Browser
Species Human (GRCh38)
Location 14:99584755-99584777
Sequence GCCCCACTGCCCACAGAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122127009_1122127014 25 Left 1122127009 14:99584707-99584729 CCAGAATAAGTTTTCTTACCAGT 0: 1
1: 0
2: 2
3: 6
4: 188
Right 1122127014 14:99584755-99584777 GCCCCACTGCCCACAGAGCGGGG 0: 1
1: 0
2: 2
3: 22
4: 223
1122127010_1122127014 7 Left 1122127010 14:99584725-99584747 CCAGTGCTCAACTTTCAAGTCCA 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1122127014 14:99584755-99584777 GCCCCACTGCCCACAGAGCGGGG 0: 1
1: 0
2: 2
3: 22
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122127014 Original CRISPR GCCCCACTGCCCACAGAGCG GGG Intronic
900151750 1:1181974-1181996 CCCCCAGTGCACACAGAGCTGGG + Intronic
900681387 1:3918723-3918745 GCCTCACATCCCACAGAGCCAGG + Intergenic
900936689 1:5770544-5770566 GCCCCACTGCACACAGCACCTGG + Intergenic
901416737 1:9121726-9121748 TTCCCACTGCCCCCAGAGCAGGG + Intronic
901865229 1:12102230-12102252 GCCCCATTGCCCTCAGAGGTGGG - Intronic
902516718 1:16993583-16993605 GCCCCACTGCCCAGAGGCAGGGG + Intronic
902767946 1:18629659-18629681 ACCCCACTGCCGAGAGAGGGCGG + Intergenic
903071430 1:20728754-20728776 TCCCCACTACCCACAGGGTGGGG - Intronic
903389654 1:22954879-22954901 GCCCCACTGCTCCCAGAGTGGGG + Intronic
905297350 1:36962550-36962572 GCCCCACTGCACACAAACCCAGG - Intronic
905601343 1:39254406-39254428 GCCCCAATGCCAACACAGCCTGG - Intronic
905791924 1:40794263-40794285 TCCCCACTGCCCACAGGGTAAGG - Intronic
908354404 1:63316965-63316987 GCCCCGGGGCCCACAGAGCGCGG - Intergenic
909115290 1:71526528-71526550 ACCCCACCACCCACAGAGAGAGG + Intronic
909204618 1:72739550-72739572 GCCTCCCTGGCCACAGAGCAAGG - Intergenic
915004359 1:152622982-152623004 GGCCCACAGCCCCCAGAGCTTGG + Exonic
915087190 1:153396825-153396847 TCCCCACTGCCCACTGGGAGGGG + Intergenic
916061068 1:161098857-161098879 ACCGCACTGGACACAGAGCGCGG + Exonic
917961892 1:180152216-180152238 GCCCCACTGACCACAGAAAGTGG + Intergenic
920286484 1:204883462-204883484 GCTGCACAGGCCACAGAGCGGGG - Intronic
920977602 1:210800657-210800679 TCCCCACTGCACTCAGAGAGAGG - Intronic
922096540 1:222447772-222447794 TTCCCACTGCCCACAGTGCTGGG + Intergenic
922421884 1:225465904-225465926 GCCAGACTGCCCACAGCCCGTGG + Intergenic
923141439 1:231163628-231163650 GTCGCACTGCTCGCAGAGCGTGG - Exonic
1063778586 10:9293562-9293584 GCCCCTCTCCCCACAGACCCTGG - Intergenic
1065081765 10:22136346-22136368 GCCCCACGGCCAACACAGCTAGG - Intergenic
1067777276 10:49172703-49172725 GCCTCATTGCACACAGAGCATGG + Intronic
1067777861 10:49176105-49176127 GCCCCATTGCACACAGAGCATGG + Intronic
1070797357 10:79224486-79224508 GCCCCCCTGCCTACAGAGCGGGG + Intronic
1071402238 10:85285157-85285179 TCCCCACTGCTCCCAGAGCGAGG - Intergenic
1073085081 10:100883167-100883189 TCCCCACTGCCCAGTGAGCTTGG - Intergenic
1073116526 10:101094631-101094653 CCCCCACTGGCAACAGAGCCAGG - Intronic
1074187341 10:111108312-111108334 GCCCAACAGCCCACAGTGGGGGG - Intergenic
1074365678 10:112855700-112855722 GACCTCCTGCCCACAGAGCTTGG + Intergenic
1075661423 10:124199582-124199604 ACCCCACTGCCCACTGACCCAGG - Intergenic
1075893323 10:125973054-125973076 GGCCCACTGCCACCAGAGCTGGG - Intronic
1076378444 10:130008917-130008939 CACCCTCTGCCCACAGAGGGGGG - Intergenic
1076793689 10:132788902-132788924 GCCCCTCAGCCCCCAGCGCGGGG - Intergenic
1077016320 11:400519-400541 GCGCCCCCGCCCGCAGAGCGTGG + Exonic
1077474066 11:2778196-2778218 GGCCCACTGCCCACCTGGCGGGG + Intronic
1078926206 11:15877791-15877813 GCCCCACTTCCCACAGGACACGG + Intergenic
1079125451 11:17715077-17715099 TCCCTGCTGCCCACAGAGCAGGG - Intergenic
1079452020 11:20605785-20605807 GCCCCTCAGCCCTCAGTGCGGGG + Intronic
1081679295 11:44990411-44990433 GCCTCACTGCTCAGAGAGTGGGG + Intergenic
1081771269 11:45651795-45651817 TCCCCTCTGCCCACAGAAGGGGG + Intronic
1082791113 11:57347399-57347421 ACCCGTCTGCCCACAGAGTGAGG + Exonic
1083221411 11:61255224-61255246 GCACCACTGCACTCAGAGCCTGG - Intergenic
1084063230 11:66689054-66689076 CCCCCACTCCCCACAGGGCCTGG + Intronic
1085395274 11:76203887-76203909 GCCCAACAGTCCACAGAGCTAGG + Intronic
1085695975 11:78705044-78705066 ACGACACTGCCCAGAGAGCGAGG - Intronic
1087761823 11:102110706-102110728 GCCCCCCGGCCCTGAGAGCGAGG + Exonic
1088685330 11:112280226-112280248 GACCAACTGCCCACACAGTGTGG + Intergenic
1089744210 11:120605732-120605754 GCCACGCTGGGCACAGAGCGTGG + Intronic
1092263231 12:6963316-6963338 GCCCACCTGCCCCCAGAGAGTGG - Intergenic
1096533708 12:52257594-52257616 GCCCAAGGGCCCACAGAGAGTGG - Intronic
1100408381 12:94290967-94290989 GCCCCTCCTCCCACAGAGCCAGG + Intronic
1102862558 12:116349398-116349420 GCCCTCCTGCCCAGAGAGCCAGG - Intergenic
1103478946 12:121238596-121238618 ACCCCACTGCCCCCACAGCTGGG + Exonic
1103775463 12:123364143-123364165 TCCCCACCGCCCCAAGAGCGGGG + Intronic
1103915437 12:124373436-124373458 GCCTCACTGCCCACTGTGCCCGG - Intronic
1103915471 12:124373562-124373584 GCCTCACTGCCCACTGTGCCCGG - Intronic
1103915483 12:124373604-124373626 GCCTCACTGCCCACTGTGCCCGG - Intronic
1104842095 12:131830218-131830240 GCCCCCCTGCCCGGAGAGAGTGG + Intronic
1104989704 12:132618745-132618767 GCCCCGCTGCGCACCGAGAGCGG - Intergenic
1107553557 13:41498425-41498447 GCCTCAGGGCCCACAGACCGTGG + Intergenic
1107751104 13:43568303-43568325 GACACATTGCCCACAGAGAGTGG + Intronic
1111998877 13:95192026-95192048 GCCCCAGGGCCCACAGAGTGGGG - Intronic
1113423941 13:110192513-110192535 GCCCCCCTGCCCACACACCCAGG + Intronic
1113793414 13:113042660-113042682 GCCTCACTGCCCACAGTGCCCGG - Intronic
1113806103 13:113110607-113110629 GCCCCACGGCCCACGCGGCGGGG - Intronic
1113933813 13:113982590-113982612 GCCTCACTGCTCACAGCGCCTGG + Intronic
1114636088 14:24187666-24187688 CCCCCACAGCCCAGAGAGAGAGG - Exonic
1117536568 14:56708225-56708247 GCCGCACTGCCCACCTAGCATGG + Intronic
1118126842 14:62914862-62914884 TCCTCACTGCCCACATGGCGAGG - Intronic
1119055145 14:71411739-71411761 GCCCCACTACCCACAGCCCCTGG + Intronic
1122127014 14:99584755-99584777 GCCCCACTGCCCACAGAGCGGGG + Intronic
1122140393 14:99659890-99659912 GCCGCACAGCCCATAGAGTGGGG - Intronic
1122888105 14:104719500-104719522 CCCTCACTGCCCACCCAGCGAGG + Exonic
1122986569 14:105214348-105214370 GCCCGAGTGACCACAGAGTGAGG + Intronic
1124231924 15:27953319-27953341 GCCCCACTGCACATAGAGGAGGG - Intronic
1125610891 15:40969530-40969552 GCACCACTGCCAACAGAGAAGGG - Intergenic
1128173149 15:65530608-65530630 GCCACACTGCCCAGGGCGCGGGG - Exonic
1129766502 15:78172836-78172858 GGACCACTGCCCACAGAACCAGG - Intronic
1132314664 15:100880728-100880750 GCCTCCCAGCCCACAGAGCGAGG - Intronic
1132542771 16:519040-519062 GCCCCACTGGCCACAGCTCCAGG - Intronic
1132648357 16:1009452-1009474 TCCCCACTGCTCACAGACCCCGG - Intergenic
1132868111 16:2103838-2103860 GCACCACAGCCCTCAGAGCTGGG - Exonic
1132975708 16:2710158-2710180 GCCCCAGTCCCCACAGCGGGCGG - Intergenic
1134180396 16:12043170-12043192 GGCCCACTTCCCCCAGATCGGGG - Intronic
1135429697 16:22373220-22373242 GCCCCACTGGCCCCAAAGAGTGG + Intronic
1136281933 16:29218355-29218377 GCCCCACTCCCCACACTGCCAGG - Intergenic
1136455822 16:30379052-30379074 GGCCCGCTGCCTACAGAGCCTGG - Exonic
1136610336 16:31362080-31362102 TCCCCACAGCCCCCAGAACGGGG - Exonic
1137609160 16:49807633-49807655 GCCCCATTGCCCACCCACCGTGG + Intronic
1138534486 16:57652790-57652812 GCCCCTCTGCCCAGGTAGCGTGG - Intronic
1139580645 16:67871879-67871901 CCTCCACTGCCCACAGAGCCAGG + Exonic
1140506611 16:75477661-75477683 GCCCCTTTGCCCCCAGAGCTAGG + Exonic
1141552550 16:84815873-84815895 TCTCCACTGCCCCCAGAGAGTGG + Intergenic
1141888884 16:86913180-86913202 GCCCCACAACACACAGAGAGAGG + Intergenic
1142893589 17:2960539-2960561 GCCCTGCTGTCCACAGAGTGTGG + Intronic
1143479448 17:7220106-7220128 CCCCCACTCCCCACAGCTCGCGG + Exonic
1144189851 17:12834591-12834613 TCCCCACTGCCAACACAGTGTGG - Intronic
1146273237 17:31498109-31498131 TCCCCACTGCCCACAGAACCAGG - Intronic
1147752431 17:42744673-42744695 GCCCCAGCGCCCAAAGGGCGCGG - Intronic
1149989887 17:61377123-61377145 GCTCCCCTGCCCACAGGGCATGG + Intronic
1151155742 17:72122205-72122227 GCCCCACTGTCCACGGAGATGGG + Intronic
1151196850 17:72437822-72437844 GGACCACAGACCACAGAGCGAGG - Intergenic
1151552885 17:74832096-74832118 CCCCCACTGCCCACCTGGCGAGG - Intronic
1151878230 17:76879368-76879390 GCCTGACTGACCACAGAGCCTGG - Intronic
1152539504 17:80967833-80967855 GCCCCGCTGCGCACACAGAGGGG + Intergenic
1152881611 17:82819666-82819688 GGCCCACTGTCCACAGGCCGAGG - Intronic
1152938855 17:83155178-83155200 GTCCCACTTCCCACAGACCCTGG + Intergenic
1154122657 18:11664340-11664362 TCCCCACTGTGCTCAGAGCGTGG + Intergenic
1154220750 18:12451622-12451644 GCCTCGCTGTCCACAGAGCCAGG + Intronic
1155046473 18:22107847-22107869 TCCCCACTGCCCACAGAAAAAGG - Intergenic
1155541084 18:26869050-26869072 GCCCCACGCCCCACAGATCCAGG + Intergenic
1155606071 18:27607120-27607142 GCACCACTGCCCTCAAAGCCTGG + Intergenic
1155733438 18:29191213-29191235 GCTCCACAGACCACAGAGCAGGG - Intergenic
1155788562 18:29933697-29933719 TCCCCACTTCCCACAGACCAGGG + Intergenic
1159971848 18:74665305-74665327 GCCCCACTGCCCTCAGAGCAGGG + Intronic
1160130619 18:76222012-76222034 TCCACTCTGCCCACAGAGCGAGG + Intergenic
1160209303 18:76862709-76862731 GCCCCACTGACCGCAGTGGGAGG - Intronic
1160354255 18:78213623-78213645 GCCCCTCTGCCGCCAGAGCAAGG + Intergenic
1160406307 18:78648769-78648791 GCCCTGCTGCCCACAGAAAGAGG + Intergenic
1160687799 19:444947-444969 GCCACACGGCCCGCAGAGCTGGG + Intronic
1161078949 19:2300871-2300893 GCCCCAGTGTTCACAGAGCCTGG - Intronic
1161126820 19:2562542-2562564 GCCCCAGTGTCCACAGTGCCCGG - Intronic
1161159301 19:2753018-2753040 GCCCCAGTGTCCACAGAGCCGGG - Intergenic
1161247257 19:3259870-3259892 GCCCCAATGTCCACAGTGCCCGG + Intronic
1161517159 19:4702908-4702930 GCCCCAGTGTCCACAGTGTGGGG - Intronic
1161517343 19:4703805-4703827 GCCCCATTGCCCCCACAGCCAGG - Intronic
1162795903 19:13087541-13087563 GCCCGACAGCCCTCAGAGGGAGG + Intronic
1162888361 19:13713447-13713469 GTCCCACGGCACACAGAGTGTGG - Intergenic
1163148873 19:15399645-15399667 GGCCCACTGCACAGAGAGCATGG - Intronic
1163462621 19:17448175-17448197 GCCCAGGTGGCCACAGAGCGCGG + Exonic
1163528986 19:17838586-17838608 GCACCACTGCCCACCCAGCCTGG - Intronic
1164608677 19:29617818-29617840 GACCCACTGCTCAAAGAGTGGGG + Intergenic
1165772146 19:38386098-38386120 GCCCCAAGGCCCAGAGAGTGCGG + Exonic
1167296273 19:48652014-48652036 GCCTCACTGCACACAGAGCCTGG + Intergenic
1167327684 19:48835605-48835627 GCCCCTCTGCCCTCAGACCCAGG - Intronic
1167674645 19:50876798-50876820 GCCCCACTTCCCTCAGACCCAGG - Intronic
1167792436 19:51690332-51690354 GCCCCTCTTCCCAAGGAGCGCGG + Intergenic
1167942995 19:52962646-52962668 GCCCCACTGCAGAAAGACCGGGG + Intronic
929558000 2:42937394-42937416 AGGCCACTCCCCACAGAGCGGGG + Intergenic
929881873 2:45843830-45843852 GTCCCCCTGCCCACAGATGGAGG - Intronic
931634374 2:64328381-64328403 TCCCCTCTGCCCACAGACCTGGG - Intergenic
932417535 2:71582762-71582784 GCACCACTGAACACAGAGCTGGG + Intronic
932431904 2:71681130-71681152 GCCCCAATGCCCACAGGTCTGGG + Intronic
933248218 2:79999401-79999423 CCCCCACTGCCCACAGTGGCAGG + Intronic
937231240 2:120399205-120399227 GCTCCACTGCCCCCACAGTGGGG - Intergenic
938068230 2:128293123-128293145 GCCCCACTGCATGCAGAGCAAGG - Intronic
938402653 2:131005721-131005743 CCCCCAGTGCCCACACAGCCTGG - Intronic
938950502 2:136250357-136250379 CCCCCACTGGCCACAGAGCAGGG - Intergenic
939791789 2:146587343-146587365 AACTCACTGGCCACAGAGCGAGG - Intergenic
942928059 2:181457231-181457253 GCCTCCCAGCCCGCAGAGCGCGG - Exonic
943559258 2:189441591-189441613 GCCCCTCAGCCGACAAAGCGCGG - Intronic
948011402 2:234652040-234652062 CCCCCACTGCCCACTGAGCTGGG - Intergenic
948546898 2:238739087-238739109 GCCCTGCTGCCCACAGACCAGGG - Intergenic
948551045 2:238773126-238773148 GACCCACCGCCCGCAGAGAGTGG - Intergenic
949041938 2:241853510-241853532 GCCCCACTGCCCACTGCCCAGGG - Intronic
1169075175 20:2755795-2755817 GCCCCAGAGCCCACGGAGAGGGG + Exonic
1169131189 20:3167078-3167100 GCCCCACGGCCCTCCGAGCTTGG - Exonic
1170573534 20:17646377-17646399 GCCCCACTGCCCAAGGACAGAGG - Intronic
1172982739 20:38956660-38956682 GCCCAACTGCCTACAGAGGTGGG - Intergenic
1174305801 20:49613491-49613513 TCCCCACTGCCCGCGGAGGGAGG - Intergenic
1174404484 20:50294583-50294605 GCCCCACAGCCCACAGCTCTCGG - Intergenic
1175290697 20:57873196-57873218 GCCCCCATGCCCACAGTGAGAGG - Intergenic
1175858067 20:62133424-62133446 ACCCCACTTCCCACAGGGCCGGG + Exonic
1176088888 20:63310249-63310271 GCCCCACTTCCCACAGGCCTGGG - Intronic
1176131966 20:63499982-63500004 TCCCCACTTCCTACAGAGCGTGG - Intergenic
1176221329 20:63970443-63970465 GAACCACTGCCCCCAGAGCTGGG - Intronic
1180120124 21:45740266-45740288 GCACCACAGACCACACAGCGGGG - Intronic
1180240287 21:46498854-46498876 GCCCCTGTGCCAGCAGAGCGGGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181427527 22:22853889-22853911 GCCCCACTGCACACCCAGCATGG - Intronic
1181444131 22:22955929-22955951 GCCCCACTGAACACAGAGTTGGG + Intergenic
1182460287 22:30478685-30478707 ACCCCTCTGCCAACAGAGCCTGG - Intergenic
1182620230 22:31614788-31614810 GCAACACTGCCCACTCAGCGAGG + Exonic
1183257214 22:36770366-36770388 GCCCCTCTGCCCCCCGAGTGTGG + Intronic
1185250430 22:49798937-49798959 GCACCACTGGCCACGGGGCGTGG - Intronic
1185332597 22:50258414-50258436 GCCCCACTGTCCAAAGGGCCTGG + Intronic
952903073 3:38122216-38122238 CCCAAACTGCCCACAGAGCCTGG + Intronic
952926640 3:38325397-38325419 CCTGCACTGCCCACAGAGCCTGG - Intergenic
952927313 3:38329453-38329475 GCCCCCCTCTCCACAGAGCCAGG - Intergenic
954426836 3:50447795-50447817 GCCCCAGTCACCACAGAGCCTGG + Intronic
956500508 3:69878532-69878554 GCCCCCTTACCCAAAGAGCGAGG + Intronic
956646741 3:71464349-71464371 GCCCTGCTCCCCACAGTGCGGGG + Intronic
958941835 3:100325440-100325462 GGCCCACTGACCACAGAGCTGGG + Intergenic
961206462 3:125086288-125086310 ACCTCACAGCCCACAGAGCCTGG + Intronic
961455872 3:127023636-127023658 GCCCCACGGCCCAGAGACAGAGG - Intronic
962379674 3:134888013-134888035 GCCCCTCTTCCCAAGGAGCGAGG + Intronic
962866676 3:139453062-139453084 TCCCCACTGCCCACACTGAGTGG - Exonic
968631091 4:1651884-1651906 GCTCCAGTTCCCACACAGCGGGG + Intronic
969610550 4:8225571-8225593 GCCACACTGCCCTCAGTGGGTGG + Intronic
971056324 4:22916991-22917013 GCCCCAGTACCCACAGGGCTTGG - Intergenic
975147115 4:70980621-70980643 GCACCCCTCCCCACAGAGTGAGG + Intronic
981986882 4:150868246-150868268 TCCCCAGTGCCCAGAGAGCATGG - Exonic
982202409 4:152973560-152973582 GCCCCACTGTCCAAAGAGCCAGG + Intronic
983249992 4:165332579-165332601 TCCCCCCTGCCCACAGTGTGTGG + Intronic
985731892 5:1553986-1554008 GCCCCAAGCCCCACAGAGCCAGG - Intergenic
985773500 5:1827635-1827657 GCCCCACAGGCCACAGGGCCAGG - Intergenic
986849544 5:11795181-11795203 GCCTTACTGCCCACAGGGTGCGG + Intronic
990665725 5:58069389-58069411 GCCCGGCTGCCCCCAGTGCGGGG + Intergenic
992287310 5:75248577-75248599 GACGCCCTGCCCACAGAGTGGGG - Intergenic
995714698 5:115070976-115070998 ACCTCACTGCCCACAGACAGCGG + Intergenic
998061084 5:139119280-139119302 GCCCCACTGCCCAGAGGGTTGGG + Intronic
998507983 5:142687293-142687315 CCCACACTCCCCACAGAGCATGG + Intronic
999262238 5:150245244-150245266 GCACCAGGGCCCACAGGGCGAGG + Intronic
1000018685 5:157300699-157300721 GCCCCTCTGCCCCCAGCGCAAGG + Exonic
1001756459 5:174174016-174174038 GCCCCACTGCCCTCAGTCCATGG + Intronic
1006101741 6:31689897-31689919 GCCCCCATCCCCACAGTGCGGGG - Intronic
1011670157 6:89675472-89675494 GATCCACTGCTCACTGAGCGTGG + Exonic
1018645293 6:165942515-165942537 GGCCCACTGTCCACAGTGGGTGG - Intronic
1019491596 7:1316326-1316348 GCCCCAGGGCCCACAGGGAGAGG - Intergenic
1019711455 7:2519952-2519974 CCTCCACTGCCCGCCGAGCGCGG + Exonic
1021581240 7:22156319-22156341 GCAGCACTGCCCACACAGCCTGG + Intronic
1022014827 7:26340579-26340601 ACCCCACTGCCCTGAGAGCATGG - Intronic
1023370219 7:39505674-39505696 GCCCCACTGGCAGCAGAGTGAGG + Intergenic
1025262216 7:57426781-57426803 GCCCCAGTGCCACCAGAGCCAGG + Intergenic
1026624427 7:71979680-71979702 GCCCCAGTTCCCATAGAGCAGGG - Intronic
1028184805 7:87769806-87769828 TCCCCACTGCCAACAGGCCGCGG + Intronic
1029284162 7:99454623-99454645 TCCCCGCTTCCCACAGAGCCAGG - Intronic
1029540121 7:101177882-101177904 GACCCATTGTCCTCAGAGCGTGG - Intronic
1034217755 7:149421312-149421334 TCCCACCGGCCCACAGAGCGGGG + Intergenic
1034747599 7:153536867-153536889 GTCCAACTCCCCACAGAGCTTGG + Intergenic
1034881756 7:154768048-154768070 GCCCCACTGCCCTTAGAGCCTGG + Intronic
1034944683 7:155254204-155254226 GCACACCTGCCCACAGAGCGGGG + Intergenic
1035476172 7:159145233-159145255 GCCCCTCCGCCCACAGATCGGGG - Intergenic
1038104207 8:24414971-24414993 GCCTCTGTGCCCACAGAGCAGGG + Intergenic
1039461860 8:37751755-37751777 AACCCACTGGCCACAGGGCGGGG - Intronic
1049325908 8:142021322-142021344 GCCCCACTGCCCAGAAAGCACGG - Intergenic
1049457271 8:142700170-142700192 ACCCCACGGCCCACAGAAAGTGG - Exonic
1049767879 8:144363361-144363383 CCCCCACTGTCCCCAGAGGGTGG + Intergenic
1053157821 9:35792371-35792393 GCCCCACCGCCCCCAGAACTTGG - Exonic
1053268364 9:36732599-36732621 CACCCACTGCCCACAGAGGAGGG + Intergenic
1056856237 9:90132002-90132024 TCCTCACTGCCCACACAGCCCGG + Intergenic
1057796430 9:98161221-98161243 TCCCCACTGCCCTCAGAGTCCGG - Intronic
1060033163 9:120232926-120232948 GCTCCAGTGCCCACAAAGTGTGG - Intergenic
1060903068 9:127278765-127278787 TCCCCACGGCCCTCAGAGGGAGG - Intronic
1061856034 9:133442510-133442532 GCCCCACAGCTCACCGAGCAGGG - Exonic
1061958361 9:133975270-133975292 GGCCCACTGAGCACTGAGCGAGG - Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062267978 9:135696077-135696099 TCCCCACTTCCCACAGACCCAGG + Intronic
1062572933 9:137193930-137193952 GCCACACGGCCCACACAGCCAGG + Intronic
1062665274 9:137667452-137667474 GCCACCCTCTCCACAGAGCGGGG - Intronic
1185617467 X:1432148-1432170 GCCACACGGCCCCCGGAGCGGGG + Intronic
1189078633 X:37944566-37944588 GCCCCACTGCCCACTTGGCATGG - Intronic
1200231194 X:154444684-154444706 GCCCCTCGGCCCTCAGAGCCAGG + Intronic