ID: 1122130748

View in Genome Browser
Species Human (GRCh38)
Location 14:99603533-99603555
Sequence GGCCCTGCTGCGCGAGAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122130748_1122130754 20 Left 1122130748 14:99603533-99603555 CCAGGTTCTCGCGCAGCAGGGCC 0: 1
1: 0
2: 3
3: 6
4: 114
Right 1122130754 14:99603576-99603598 GCGCAGCTTCTGCTGCGAGCGGG 0: 1
1: 0
2: 1
3: 9
4: 140
1122130748_1122130753 19 Left 1122130748 14:99603533-99603555 CCAGGTTCTCGCGCAGCAGGGCC 0: 1
1: 0
2: 3
3: 6
4: 114
Right 1122130753 14:99603575-99603597 CGCGCAGCTTCTGCTGCGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122130748 Original CRISPR GGCCCTGCTGCGCGAGAACC TGG (reversed) Exonic