ID: 1122131560

View in Genome Browser
Species Human (GRCh38)
Location 14:99606816-99606838
Sequence TGGGAATGCTTGGGCAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122131554_1122131560 -9 Left 1122131554 14:99606802-99606824 CCCCACACCAGGGCTGGGAATGC No data
Right 1122131560 14:99606816-99606838 TGGGAATGCTTGGGCAGAACAGG No data
1122131555_1122131560 -10 Left 1122131555 14:99606803-99606825 CCCACACCAGGGCTGGGAATGCT No data
Right 1122131560 14:99606816-99606838 TGGGAATGCTTGGGCAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122131560 Original CRISPR TGGGAATGCTTGGGCAGAAC AGG Intergenic
No off target data available for this crispr