ID: 1122133404

View in Genome Browser
Species Human (GRCh38)
Location 14:99619110-99619132
Sequence CCGTGTACTGGCCCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122133392_1122133404 15 Left 1122133392 14:99619072-99619094 CCGAGCCTCACCATGATCTCACT No data
Right 1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG No data
1122133391_1122133404 20 Left 1122133391 14:99619067-99619089 CCTCACCGAGCCTCACCATGATC No data
Right 1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG No data
1122133394_1122133404 5 Left 1122133394 14:99619082-99619104 CCATGATCTCACTATCCCTCCCG No data
Right 1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG No data
1122133393_1122133404 10 Left 1122133393 14:99619077-99619099 CCTCACCATGATCTCACTATCCC No data
Right 1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG No data
1122133395_1122133404 -10 Left 1122133395 14:99619097-99619119 CCCTCCCGACACCCCGTGTACTG No data
Right 1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122133404 Original CRISPR CCGTGTACTGGCCCTGGTGC TGG Intergenic
No off target data available for this crispr