ID: 1122133695

View in Genome Browser
Species Human (GRCh38)
Location 14:99620550-99620572
Sequence TCTGCCCTTAGCCCCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122133695_1122133702 11 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133702 14:99620584-99620606 CCCAGCTGTCACCACTCAGGTGG No data
1122133695_1122133700 8 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133700 14:99620581-99620603 CCTCCCAGCTGTCACCACTCAGG No data
1122133695_1122133709 19 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133709 14:99620592-99620614 TCACCACTCAGGTGGGGGGCGGG No data
1122133695_1122133705 13 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133705 14:99620586-99620608 CAGCTGTCACCACTCAGGTGGGG No data
1122133695_1122133704 12 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133704 14:99620585-99620607 CCAGCTGTCACCACTCAGGTGGG No data
1122133695_1122133711 24 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133711 14:99620597-99620619 ACTCAGGTGGGGGGCGGGTCAGG No data
1122133695_1122133706 14 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133706 14:99620587-99620609 AGCTGTCACCACTCAGGTGGGGG No data
1122133695_1122133707 15 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133707 14:99620588-99620610 GCTGTCACCACTCAGGTGGGGGG No data
1122133695_1122133708 18 Left 1122133695 14:99620550-99620572 CCCGCAGGGGGGCTAAGGGCAGA No data
Right 1122133708 14:99620591-99620613 GTCACCACTCAGGTGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122133695 Original CRISPR TCTGCCCTTAGCCCCCCTGC GGG (reversed) Intergenic
No off target data available for this crispr