ID: 1122133768

View in Genome Browser
Species Human (GRCh38)
Location 14:99620820-99620842
Sequence GGGTGTCCCCAGAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122133768_1122133776 6 Left 1122133768 14:99620820-99620842 CCCATTTCCCTCTGGGGACACCC No data
Right 1122133776 14:99620849-99620871 GGAGCAGCAGGAGTCAGACCTGG No data
1122133768_1122133778 13 Left 1122133768 14:99620820-99620842 CCCATTTCCCTCTGGGGACACCC No data
Right 1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG No data
1122133768_1122133777 9 Left 1122133768 14:99620820-99620842 CCCATTTCCCTCTGGGGACACCC No data
Right 1122133777 14:99620852-99620874 GCAGCAGGAGTCAGACCTGGAGG No data
1122133768_1122133773 -6 Left 1122133768 14:99620820-99620842 CCCATTTCCCTCTGGGGACACCC No data
Right 1122133773 14:99620837-99620859 ACACCCTCTGAAGGAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122133768 Original CRISPR GGGTGTCCCCAGAGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr