ID: 1122133773

View in Genome Browser
Species Human (GRCh38)
Location 14:99620837-99620859
Sequence ACACCCTCTGAAGGAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122133763_1122133773 15 Left 1122133763 14:99620799-99620821 CCCATCTCTGGAGCACTCTAGCC No data
Right 1122133773 14:99620837-99620859 ACACCCTCTGAAGGAGCAGCAGG No data
1122133764_1122133773 14 Left 1122133764 14:99620800-99620822 CCATCTCTGGAGCACTCTAGCCC No data
Right 1122133773 14:99620837-99620859 ACACCCTCTGAAGGAGCAGCAGG No data
1122133769_1122133773 -7 Left 1122133769 14:99620821-99620843 CCATTTCCCTCTGGGGACACCCT No data
Right 1122133773 14:99620837-99620859 ACACCCTCTGAAGGAGCAGCAGG No data
1122133768_1122133773 -6 Left 1122133768 14:99620820-99620842 CCCATTTCCCTCTGGGGACACCC No data
Right 1122133773 14:99620837-99620859 ACACCCTCTGAAGGAGCAGCAGG No data
1122133761_1122133773 28 Left 1122133761 14:99620786-99620808 CCTCTGGGCAGGGCCCATCTCTG No data
Right 1122133773 14:99620837-99620859 ACACCCTCTGAAGGAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122133773 Original CRISPR ACACCCTCTGAAGGAGCAGC AGG Intergenic
No off target data available for this crispr