ID: 1122133777

View in Genome Browser
Species Human (GRCh38)
Location 14:99620852-99620874
Sequence GCAGCAGGAGTCAGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122133764_1122133777 29 Left 1122133764 14:99620800-99620822 CCATCTCTGGAGCACTCTAGCCC No data
Right 1122133777 14:99620852-99620874 GCAGCAGGAGTCAGACCTGGAGG No data
1122133768_1122133777 9 Left 1122133768 14:99620820-99620842 CCCATTTCCCTCTGGGGACACCC No data
Right 1122133777 14:99620852-99620874 GCAGCAGGAGTCAGACCTGGAGG No data
1122133770_1122133777 2 Left 1122133770 14:99620827-99620849 CCCTCTGGGGACACCCTCTGAAG No data
Right 1122133777 14:99620852-99620874 GCAGCAGGAGTCAGACCTGGAGG No data
1122133769_1122133777 8 Left 1122133769 14:99620821-99620843 CCATTTCCCTCTGGGGACACCCT No data
Right 1122133777 14:99620852-99620874 GCAGCAGGAGTCAGACCTGGAGG No data
1122133771_1122133777 1 Left 1122133771 14:99620828-99620850 CCTCTGGGGACACCCTCTGAAGG No data
Right 1122133777 14:99620852-99620874 GCAGCAGGAGTCAGACCTGGAGG No data
1122133763_1122133777 30 Left 1122133763 14:99620799-99620821 CCCATCTCTGGAGCACTCTAGCC No data
Right 1122133777 14:99620852-99620874 GCAGCAGGAGTCAGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122133777 Original CRISPR GCAGCAGGAGTCAGACCTGG AGG Intergenic
No off target data available for this crispr