ID: 1122133778

View in Genome Browser
Species Human (GRCh38)
Location 14:99620856-99620878
Sequence CAGGAGTCAGACCTGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122133769_1122133778 12 Left 1122133769 14:99620821-99620843 CCATTTCCCTCTGGGGACACCCT No data
Right 1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG No data
1122133775_1122133778 -8 Left 1122133775 14:99620841-99620863 CCTCTGAAGGAGCAGCAGGAGTC No data
Right 1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG No data
1122133770_1122133778 6 Left 1122133770 14:99620827-99620849 CCCTCTGGGGACACCCTCTGAAG No data
Right 1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG No data
1122133771_1122133778 5 Left 1122133771 14:99620828-99620850 CCTCTGGGGACACCCTCTGAAGG No data
Right 1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG No data
1122133768_1122133778 13 Left 1122133768 14:99620820-99620842 CCCATTTCCCTCTGGGGACACCC No data
Right 1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG No data
1122133774_1122133778 -7 Left 1122133774 14:99620840-99620862 CCCTCTGAAGGAGCAGCAGGAGT No data
Right 1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122133778 Original CRISPR CAGGAGTCAGACCTGGAGGC CGG Intergenic
No off target data available for this crispr