ID: 1122136407

View in Genome Browser
Species Human (GRCh38)
Location 14:99635386-99635408
Sequence GTGGCTTTGGACTGAGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122136402_1122136407 -3 Left 1122136402 14:99635366-99635388 CCCCTGCTGTGAAGAATCTAGTG No data
Right 1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG No data
1122136398_1122136407 8 Left 1122136398 14:99635355-99635377 CCCTGTCCCTGCCCCTGCTGTGA No data
Right 1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG No data
1122136401_1122136407 1 Left 1122136401 14:99635362-99635384 CCTGCCCCTGCTGTGAAGAATCT No data
Right 1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG No data
1122136399_1122136407 7 Left 1122136399 14:99635356-99635378 CCTGTCCCTGCCCCTGCTGTGAA No data
Right 1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG No data
1122136403_1122136407 -4 Left 1122136403 14:99635367-99635389 CCCTGCTGTGAAGAATCTAGTGG No data
Right 1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG No data
1122136405_1122136407 -5 Left 1122136405 14:99635368-99635390 CCTGCTGTGAAGAATCTAGTGGC No data
Right 1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG No data
1122136400_1122136407 2 Left 1122136400 14:99635361-99635383 CCCTGCCCCTGCTGTGAAGAATC No data
Right 1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122136407 Original CRISPR GTGGCTTTGGACTGAGAAGC CGG Intergenic
No off target data available for this crispr