ID: 1122136733

View in Genome Browser
Species Human (GRCh38)
Location 14:99637680-99637702
Sequence CTCAGGGAACATTCTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122136733_1122136738 -3 Left 1122136733 14:99637680-99637702 CCTTCAGGAGAATGTTCCCTGAG No data
Right 1122136738 14:99637700-99637722 GAGCAGAGGAAAAGGTTCTGAGG No data
1122136733_1122136740 14 Left 1122136733 14:99637680-99637702 CCTTCAGGAGAATGTTCCCTGAG No data
Right 1122136740 14:99637717-99637739 CTGAGGCTCACGTGAGGCCATGG No data
1122136733_1122136739 8 Left 1122136733 14:99637680-99637702 CCTTCAGGAGAATGTTCCCTGAG No data
Right 1122136739 14:99637711-99637733 AAGGTTCTGAGGCTCACGTGAGG No data
1122136733_1122136741 21 Left 1122136733 14:99637680-99637702 CCTTCAGGAGAATGTTCCCTGAG No data
Right 1122136741 14:99637724-99637746 TCACGTGAGGCCATGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122136733 Original CRISPR CTCAGGGAACATTCTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr