ID: 1122136856

View in Genome Browser
Species Human (GRCh38)
Location 14:99638422-99638444
Sequence CGCATCGGCTCCAGCAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122136856_1122136869 29 Left 1122136856 14:99638422-99638444 CCTGGTCTGCTGGAGCCGATGCG No data
Right 1122136869 14:99638474-99638496 GAGAGGCGCTGGGTGTCCACTGG No data
1122136856_1122136867 19 Left 1122136856 14:99638422-99638444 CCTGGTCTGCTGGAGCCGATGCG No data
Right 1122136867 14:99638464-99638486 AGTCTGGCCAGAGAGGCGCTGGG No data
1122136856_1122136859 3 Left 1122136856 14:99638422-99638444 CCTGGTCTGCTGGAGCCGATGCG No data
Right 1122136859 14:99638448-99638470 GTGCCCATACCGACCCAGTCTGG No data
1122136856_1122136866 18 Left 1122136856 14:99638422-99638444 CCTGGTCTGCTGGAGCCGATGCG No data
Right 1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG No data
1122136856_1122136863 12 Left 1122136856 14:99638422-99638444 CCTGGTCTGCTGGAGCCGATGCG No data
Right 1122136863 14:99638457-99638479 CCGACCCAGTCTGGCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122136856 Original CRISPR CGCATCGGCTCCAGCAGACC AGG (reversed) Intergenic
No off target data available for this crispr