ID: 1122136866

View in Genome Browser
Species Human (GRCh38)
Location 14:99638463-99638485
Sequence CAGTCTGGCCAGAGAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122136856_1122136866 18 Left 1122136856 14:99638422-99638444 CCTGGTCTGCTGGAGCCGATGCG No data
Right 1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG No data
1122136858_1122136866 3 Left 1122136858 14:99638437-99638459 CCGATGCGTAGGTGCCCATACCG No data
Right 1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122136866 Original CRISPR CAGTCTGGCCAGAGAGGCGC TGG Intergenic
No off target data available for this crispr