ID: 1122138146

View in Genome Browser
Species Human (GRCh38)
Location 14:99646219-99646241
Sequence CCAAGTGGGCAAATGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122138137_1122138146 -4 Left 1122138137 14:99646200-99646222 CCCCAGGGCCTGACCACACCCAA 0: 1
1: 0
2: 3
3: 29
4: 332
Right 1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 154
1122138130_1122138146 30 Left 1122138130 14:99646166-99646188 CCGCTATTTGTTTTCCTCTTGTG 0: 1
1: 0
2: 3
3: 39
4: 466
Right 1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 154
1122138139_1122138146 -6 Left 1122138139 14:99646202-99646224 CCAGGGCCTGACCACACCCAAGT 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 154
1122138138_1122138146 -5 Left 1122138138 14:99646201-99646223 CCCAGGGCCTGACCACACCCAAG 0: 1
1: 0
2: 0
3: 32
4: 226
Right 1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 154
1122138134_1122138146 16 Left 1122138134 14:99646180-99646202 CCTCTTGTGGGAGTCTGAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122138146 Original CRISPR CCAAGTGGGCAAATGTTGCC TGG Intronic
900622971 1:3595878-3595900 CCAAGTGGGCCCATGGTGCCCGG + Intronic
901410474 1:9079559-9079581 CCTAGGAGGCAAATGTTGCAGGG - Intronic
904354153 1:29927667-29927689 CCTGGTGGGCAAATATTGCCAGG + Intergenic
906271016 1:44478783-44478805 TCTACTGGGCAAATGTTGACAGG + Intronic
907758664 1:57336445-57336467 CCAAGTATGCTAATGTTACCAGG + Intronic
907766025 1:57411429-57411451 CCCAATGGGCAAATTTTGGCTGG - Intronic
907962221 1:59294392-59294414 CCCAGTGGGCACATGTAGCAGGG - Intergenic
909863025 1:80632852-80632874 CCCAGTGGGCATGTGTTGCAGGG - Intergenic
911334758 1:96569311-96569333 CCAAGTGTGCAAATATTTCCAGG + Intergenic
912046015 1:105458677-105458699 CTTAGTGGGGAAATTTTGCCTGG - Intergenic
915302483 1:154959446-154959468 CCCAGTGGGCAGATGATGCCGGG - Exonic
915648199 1:157288831-157288853 GCTTGTGAGCAAATGTTGCCAGG + Intergenic
916824413 1:168430231-168430253 TCAAATGGTCAAATGTTACCCGG - Intergenic
920872903 1:209808754-209808776 CTAAATGGGCAACTGTTGCCAGG - Intergenic
921771640 1:219047591-219047613 ACAAGTGGGGAAATTGTGCCAGG + Intergenic
1068669435 10:59709241-59709263 CAAAGTGGGCAAGTTTTCCCGGG - Intronic
1068682260 10:59833150-59833172 CCAAGAGGGAAAATGTTGGCTGG + Intronic
1070921775 10:80191755-80191777 CCGACTGGGCAAATGCTGACTGG - Intronic
1072632462 10:97155710-97155732 CCAAGTAGGCAAATCATGCCAGG + Intronic
1078117095 11:8464508-8464530 TCAAGTAGGCAAGTGCTGCCTGG - Intronic
1078129926 11:8605028-8605050 CCAAGTGGGCAAATATTTTGAGG + Intergenic
1078702317 11:13698267-13698289 CCAAGAGAGCAGATCTTGCCTGG - Intronic
1079960774 11:26920458-26920480 AGAAGTGGGCAACTGTGGCCAGG + Intergenic
1081033541 11:38114619-38114641 CCCAGAGGGCAAAGGTTGTCTGG + Intergenic
1083139023 11:60706270-60706292 CCCACTGGGCAAATGATGGCAGG + Intronic
1083537325 11:63481560-63481582 CTAAGTGGGCACCTGTTTCCGGG - Intronic
1084673910 11:70623372-70623394 CCAAAAGGGCAAATGGTGCGTGG - Intronic
1085182634 11:74548591-74548613 GCAATTGGTCAAATGTTTCCTGG + Intronic
1085767367 11:79294916-79294938 CCAAATGGGCATTTGCTGCCTGG + Intronic
1086644557 11:89203905-89203927 CCAAGTCAGCAAAAGTTGACTGG + Intronic
1089235215 11:117018596-117018618 GCAAGTGGGCAAATGTTGCTGGG + Intronic
1089625793 11:119750049-119750071 CAAGGTGGCCAAATTTTGCCAGG + Intergenic
1089741694 11:120588906-120588928 CTAAGAGTGCAAATGTTGGCTGG + Intronic
1097494113 12:60308566-60308588 CCAGGTGAGCATATATTGCCTGG - Intergenic
1099658081 12:85521302-85521324 ACAGGTGGGCACATGATGCCTGG + Intergenic
1100480143 12:94970025-94970047 CCACTTGGGCACATGTTGTCAGG - Intronic
1104520604 12:129471281-129471303 CAAAGTGAGCACATGTTGCTGGG - Intronic
1112704551 13:102051631-102051653 CAGAGTTGGCAAATGTTGCAGGG - Intronic
1114991822 14:28297771-28297793 ACAATTGGGAAAATGTTTCCAGG + Intergenic
1117229333 14:53699505-53699527 TCAAGTCGGCAAAAGTGGCCAGG + Intergenic
1120211868 14:81641464-81641486 CCAAGTGGGCATGTGTTACCGGG + Intergenic
1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG + Intronic
1122433800 14:101677877-101677899 CCCAGTGGGCAAGTGTGGTCTGG - Intergenic
1122876486 14:104668541-104668563 CCAAATAGGCAAATGTCCCCAGG - Intergenic
1123158271 14:106251819-106251841 CCAATGGGGAAAATGTTCCCAGG + Intergenic
1129857834 15:78837601-78837623 CCAAGAGGGCAAATGTGGGTGGG + Intronic
1131262898 15:90897837-90897859 CCAAATGGGCAAATGTTTCAGGG - Intergenic
1133555347 16:6901431-6901453 CCAAGAGGTCAAAGGGTGCCTGG + Intronic
1134335557 16:13296350-13296372 ACAAATGGGTAAATATTGCCAGG - Intergenic
1135121091 16:19767192-19767214 CCCAGTGGGCATATGTTACCAGG + Intronic
1139691201 16:68643147-68643169 GCAAGTGCCCAAATGCTGCCTGG - Intronic
1140838555 16:78818086-78818108 CCTATTGGGCTAATGTGGCCAGG + Intronic
1141407899 16:83809542-83809564 CCAGGAGGGCAAAGGTTGCAGGG - Intronic
1143668845 17:8382819-8382841 CCCAGTGGGCAAGTGTGGTCTGG + Exonic
1144310726 17:14011824-14011846 CAAAGTTGGCAAATGTGTCCAGG - Intergenic
1146370867 17:32265271-32265293 CCATGTGGTCAAATGAAGCCTGG + Intergenic
1147157850 17:38553364-38553386 CCAAGGGGGCAGATGGTGCAGGG - Intronic
1148093254 17:45035183-45035205 CAAAGAAGGCAAATGTGGCCAGG + Intronic
1148326577 17:46786519-46786541 ACAGGTGGGCAAGTGCTGCCTGG + Intronic
1148989805 17:51655997-51656019 GCAGGTGGAGAAATGTTGCCAGG + Intronic
1150555255 17:66248561-66248583 TCCAGTTGGCAAGTGTTGCCAGG - Intronic
1153213633 18:2795596-2795618 CCATGTGGACAAATTTTGCAGGG - Intronic
1157985979 18:52437746-52437768 CCTAGTGGTTAAATTTTGCCTGG - Intronic
1160165352 18:76506733-76506755 CCACGTGGGGAAATGGTGACTGG + Intergenic
1166449262 19:42884255-42884277 CCACGTGGGCAAGTGCTTCCAGG - Intronic
1166465931 19:43031044-43031066 CCACGTGGGCAAGTGCTTCCAGG - Intronic
1166958299 19:46480747-46480769 CCAAGTGAGGAATTGTGGCCAGG + Intergenic
1167395087 19:49223223-49223245 AACAGTGGGCAAATGGTGCCTGG + Intergenic
926089229 2:10039511-10039533 CCAGGTGGGCAAATGATGGAGGG + Intergenic
926166101 2:10522807-10522829 TCAAGTGAGCAGATGGTGCCAGG - Intergenic
926578320 2:14607377-14607399 CCACATGGGCAAATGTCCCCTGG - Intergenic
927690542 2:25204842-25204864 CCAAGTGAGCAAAAGTTCTCTGG - Intergenic
929936671 2:46298404-46298426 CCAAGTGGGCAAAGGGGGGCGGG + Intronic
931690901 2:64834188-64834210 TGAAGGGGGCTAATGTTGCCAGG + Intergenic
931796937 2:65720252-65720274 ACAAGTGGGAAAATGTGGTCCGG + Intergenic
934579955 2:95429935-95429957 TCAAGTGGTCACATGTTCCCTGG + Intergenic
934599492 2:95646790-95646812 TCAAGTGGTCACATGTTCCCTGG - Intergenic
935460193 2:103321878-103321900 CCAAGTGAGCACATGTTGTTGGG - Intergenic
936532834 2:113288798-113288820 TCAAGTGGTCACATGTTCCCTGG - Intergenic
937664007 2:124463644-124463666 ACAAGGGGGCAAATTTTGCCAGG + Intronic
938130164 2:128708293-128708315 CAAAGTGATCAAATGTGGCCTGG - Intergenic
939112566 2:138026319-138026341 CCAAATGGCAAACTGTTGCCTGG - Intergenic
939749212 2:146020236-146020258 GCAAGTGGGCAAATTTTCCAAGG + Intergenic
939998228 2:148940351-148940373 TCAAGTAGGCAGATGTTGCTAGG + Intronic
942388284 2:175464523-175464545 CCAAATGGGGATATGCTGCCTGG + Intergenic
942728516 2:179037097-179037119 CCAAGTGGGGACATCTGGCCAGG + Intronic
944781759 2:203025761-203025783 CCAGTTGGGCAAATATTGCCTGG + Intronic
945705968 2:213232164-213232186 GCAGGTGGGCAAATGTTGTAAGG - Intergenic
945829317 2:214764032-214764054 CCAATTGGGCAAAAGCTGCCAGG + Intronic
947122778 2:226835385-226835407 CAAAATGGGCAAACGTTGCGTGG + Intergenic
948713440 2:239840405-239840427 GCAAACGGGCAAAGGTTGCCTGG - Intergenic
948783642 2:240340011-240340033 CCTGGTGGGCAGATGCTGCCTGG - Intergenic
1168966632 20:1902607-1902629 CCAAGTAAACAAATGATGCCAGG + Intronic
1169548331 20:6674109-6674131 CCAAGTGAGAAAATGATGACAGG + Intergenic
1176096624 20:63347291-63347313 GCAGATGGGCAAATGTGGCCCGG + Intronic
1176108329 20:63399803-63399825 CCAAGTGGACACATGGTGACCGG + Intergenic
1178818158 21:35950518-35950540 GCCTGTGGGCAAATGTTGGCAGG + Intronic
1179141023 21:38725382-38725404 CTCACTTGGCAAATGTTGCCAGG - Intergenic
1180205120 21:46255128-46255150 CACTGTGGGCAAATGCTGCCAGG + Intronic
1180593914 22:16961664-16961686 AGAAGTGGGGAAATGTGGCCAGG - Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
950967342 3:17155411-17155433 ACAAGTGGCCCAATGTTGCATGG + Intergenic
952130574 3:30356977-30356999 CCAAGTGGGCAAGTGGAGGCAGG - Intergenic
953064388 3:39455985-39456007 CCACGTGGTCAAATGAAGCCTGG + Intergenic
953772898 3:45792480-45792502 CCAACAGGGCAGATGTTACCAGG + Intronic
954650119 3:52156028-52156050 CCACTTGGGCACATGTTGTCAGG + Intergenic
958970029 3:100601095-100601117 CCAAGTAGGCCACTCTTGCCTGG - Intergenic
960668363 3:120132697-120132719 TCAAGATGGCAAATGTTTCCTGG - Intergenic
961047551 3:123720001-123720023 CCAAGAGCCCAAATGCTGCCGGG + Intronic
961063495 3:123853469-123853491 CCCCTGGGGCAAATGTTGCCAGG - Intronic
961684323 3:128618827-128618849 CCAAGTGGAAAAATGTTTCCAGG - Intergenic
963122492 3:141788118-141788140 CCAAGTGGGTAACTCTTCCCTGG + Intronic
965093566 3:164193227-164193249 CCAAGCTGGCAAGTCTTGCCTGG - Intergenic
966217724 3:177520138-177520160 CCCAGTGGGCATGTGTTACCAGG - Intergenic
966553708 3:181233961-181233983 CCACGTGGGTAAAGGTTGCAAGG + Intergenic
969619673 4:8272805-8272827 CCAGGTGGGGAAATGGGGCCTGG + Intronic
970381838 4:15516253-15516275 TCAAGTAGGAAAATGTTGCCAGG - Intronic
970798765 4:19947102-19947124 GCAAATGGGCAAAAGTTGCAAGG - Intergenic
971011403 4:22440217-22440239 CCAAATCTGCAAATGTTTCCTGG + Intronic
978985297 4:115004779-115004801 CTAACTGGGCAAAAGTTCCCAGG + Intronic
983639889 4:169935373-169935395 CACCGTGGGCACATGTTGCCAGG + Intergenic
985027421 4:185751924-185751946 CCCAGTTGTCAAATGTTCCCTGG - Intronic
986933398 5:12854591-12854613 CCCAGAGGGCAAATGTTCTCTGG + Intergenic
988397635 5:30715124-30715146 CCAACTGGGCAAATGTTTCTAGG + Intergenic
989560715 5:42847192-42847214 CAAAGAAGGTAAATGTTGCCGGG + Intronic
991638493 5:68730598-68730620 CCATGTGGGAAATTGTTGTCTGG - Intergenic
993713692 5:91253285-91253307 CCAAGAGGTCAAAAGTAGCCTGG + Intergenic
994162703 5:96574350-96574372 GAAAGTGGGCAAATGAGGCCGGG - Intronic
995450779 5:112297880-112297902 CAAAGTGGGGAAATGGTGCTGGG - Intronic
995716577 5:115086708-115086730 CAAAGAAGGCAAATGTTACCTGG - Intergenic
996538086 5:124599604-124599626 CTCTGTGGGCAAATGTTCCCAGG - Intergenic
997782745 5:136676345-136676367 CCAAGTGTGTCAATGTTTCCTGG - Intergenic
998025997 5:138816994-138817016 TAAAATGGGCAAATGTAGCCGGG - Intronic
998844974 5:146299801-146299823 AAAAGTGGGCAAAGGTGGCCAGG - Intronic
1001808647 5:174610145-174610167 CCAAGAGGGCAGATGTGGGCAGG + Intergenic
1004551918 6:16656159-16656181 TCAAATGGGCAAATGGGGCCAGG + Intronic
1005812520 6:29528403-29528425 CCAAGAGGGCAGAGGTTACCTGG - Intergenic
1011065306 6:83319782-83319804 CTAACTGGGCACATGTTGCCAGG - Intronic
1012097231 6:94977615-94977637 ACAATGGGGGAAATGTTGCCAGG - Intergenic
1012440229 6:99255399-99255421 CCCAGTGGGCATGTGTTACCGGG - Intergenic
1013113046 6:107079472-107079494 CCCAGTGGGCATATGTTACAGGG - Intronic
1018179945 6:161214263-161214285 CCACCTGGGCACATGTTGTCAGG + Intronic
1018667227 6:166149716-166149738 CCCACTGGGCAGATGTTGCCAGG + Intergenic
1020442823 7:8236787-8236809 GCAAGTGGGCTAATGTGGCTGGG - Intronic
1021912864 7:25403762-25403784 GTAAGTAGGCAAATGCTGCCTGG - Intergenic
1023287352 7:38632748-38632770 CCCAGAGGGCAAAACTTGCCTGG - Intergenic
1023501684 7:40857428-40857450 GCAAGTGTGAAAAAGTTGCCAGG + Intronic
1025099825 7:56125000-56125022 CAAAGTTGGAGAATGTTGCCAGG - Intergenic
1029477172 7:100792023-100792045 CCAAGTGTCCGAATGTAGCCCGG + Exonic
1029679436 7:102098029-102098051 CAGAGAGGGCAAAGGTTGCCTGG + Intronic
1031202048 7:118700640-118700662 CCAAGATGGCAAATGTTCACAGG - Intergenic
1035125563 7:156606308-156606330 CCAACTGGCCAAATGTAGCAGGG - Intergenic
1036191166 8:6671503-6671525 CCATGGGGGCAAAGGTTGCCAGG + Intergenic
1038902579 8:31860502-31860524 AATAATGGGCAAATGTTGCCTGG - Intronic
1038938518 8:32278751-32278773 CACAGAGGGCAATTGTTGCCTGG - Intronic
1039865649 8:41499278-41499300 CCCAGTGGGCATATGTTACAGGG + Intronic
1040414242 8:47182674-47182696 CCCAGAGGGAAAATGGTGCCAGG - Intergenic
1040459634 8:47634788-47634810 CTAAGTCAGCAAAGGTTGCCTGG - Intronic
1047034145 8:120916041-120916063 CCAATTGGATAACTGTTGCCAGG + Intergenic
1050155943 9:2666677-2666699 CCAATGGGGTAAATGTTTCCAGG + Intergenic
1050345506 9:4681991-4682013 CCAAATGGCCAAATGTTGTCTGG + Intronic
1052915448 9:33921738-33921760 CCACGTGGGCAACTGTTTCAGGG - Exonic
1056840957 9:89997632-89997654 CCAAGGGGGCAGATGCTGCCAGG + Intergenic
1060378231 9:123138429-123138451 CCAAGTGGGCCAGTGTGGACAGG - Intronic
1060526953 9:124326221-124326243 CCCAGTGGGTAACTGGTGCCTGG - Intronic
1060803342 9:126558263-126558285 CCAAGGGGACAAATGAAGCCTGG - Intergenic
1060841467 9:126796492-126796514 CCCAGTGGACAAATATTGCCAGG - Intergenic
1060903350 9:127281431-127281453 CCAAGAGGATAAATGTTGGCTGG - Intronic
1061014496 9:127974050-127974072 CACAGTGGCCAAATGTAGCCAGG - Intronic
1061201062 9:129138827-129138849 CCAAGTCAGCAAATGGAGCCGGG + Intronic
1186442658 X:9599440-9599462 CCAGGTTGGGAAAAGTTGCCAGG + Intronic
1189163912 X:38840124-38840146 ACAAGTAGGCAAATATTGACAGG + Intergenic
1193696220 X:84709780-84709802 CCAAGTGGGCATATGTTGTCAGG - Intergenic
1195742996 X:108085006-108085028 GCAAGTGGCCAAAGGTGGCCTGG - Exonic
1198393315 X:136198126-136198148 CCAAGTGTTCAAAAGTTGTCTGG + Intronic
1198862644 X:141087615-141087637 GCACATGGGCACATGTTGCCAGG + Intergenic
1198900050 X:141499771-141499793 GCACATGGGCACATGTTGCCAGG - Intergenic
1199020262 X:142870331-142870353 ACAATGGGGAAAATGTTGCCAGG + Intergenic
1200211976 X:154350764-154350786 CCAATTGGGAAAGGGTTGCCTGG + Intronic