ID: 1122144752

View in Genome Browser
Species Human (GRCh38)
Location 14:99682966-99682988
Sequence CAGCAGAGCATCCATCCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144752_1122144761 9 Left 1122144752 14:99682966-99682988 CCGGGGGGATGGATGCTCTGCTG No data
Right 1122144761 14:99682998-99683020 CCAGGCTGCGGTGGCCCCGAGGG No data
1122144752_1122144754 -3 Left 1122144752 14:99682966-99682988 CCGGGGGGATGGATGCTCTGCTG No data
Right 1122144754 14:99682986-99683008 CTGCCCACCTGTCCAGGCTGCGG No data
1122144752_1122144759 8 Left 1122144752 14:99682966-99682988 CCGGGGGGATGGATGCTCTGCTG No data
Right 1122144759 14:99682997-99683019 TCCAGGCTGCGGTGGCCCCGAGG No data
1122144752_1122144753 -9 Left 1122144752 14:99682966-99682988 CCGGGGGGATGGATGCTCTGCTG No data
Right 1122144753 14:99682980-99683002 GCTCTGCTGCCCACCTGTCCAGG No data
1122144752_1122144756 0 Left 1122144752 14:99682966-99682988 CCGGGGGGATGGATGCTCTGCTG No data
Right 1122144756 14:99682989-99683011 CCCACCTGTCCAGGCTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144752 Original CRISPR CAGCAGAGCATCCATCCCCC CGG (reversed) Intergenic
No off target data available for this crispr