ID: 1122144950

View in Genome Browser
Species Human (GRCh38)
Location 14:99683718-99683740
Sequence CAGTCCACGCCTAGCGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144950_1122144959 2 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144959 14:99683743-99683765 CGGGCGGAGGAGGCGCCCCGGGG No data
1122144950_1122144968 30 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144968 14:99683771-99683793 GGAGAACAACTTTGGGGGTCTGG No data
1122144950_1122144965 23 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144965 14:99683764-99683786 GGCAACTGGAGAACAACTTTGGG No data
1122144950_1122144960 9 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144960 14:99683750-99683772 AGGAGGCGCCCCGGGGCAACTGG No data
1122144950_1122144966 24 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144966 14:99683765-99683787 GCAACTGGAGAACAACTTTGGGG No data
1122144950_1122144956 0 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144956 14:99683741-99683763 TCCGGGCGGAGGAGGCGCCCCGG No data
1122144950_1122144955 -8 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144950_1122144964 22 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144964 14:99683763-99683785 GGGCAACTGGAGAACAACTTTGG No data
1122144950_1122144958 1 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144958 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
1122144950_1122144967 25 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144967 14:99683766-99683788 CAACTGGAGAACAACTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144950 Original CRISPR CAGTCCACGCCTAGCGCCCG TGG (reversed) Intergenic