ID: 1122144955

View in Genome Browser
Species Human (GRCh38)
Location 14:99683733-99683755
Sequence GTGGACTGTCCGGGCGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144937_1122144955 20 Left 1122144937 14:99683690-99683712 CCACCAGCCCGCGGGCCCCGCTG No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144941_1122144955 13 Left 1122144941 14:99683697-99683719 CCCGCGGGCCCCGCTGGCGGACC No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144936_1122144955 24 Left 1122144936 14:99683686-99683708 CCTGCCACCAGCCCGCGGGCCCC No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144947_1122144955 3 Left 1122144947 14:99683707-99683729 CCGCTGGCGGACCACGGGCGCTA No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144942_1122144955 12 Left 1122144942 14:99683698-99683720 CCGCGGGCCCCGCTGGCGGACCA No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144946_1122144955 4 Left 1122144946 14:99683706-99683728 CCCGCTGGCGGACCACGGGCGCT No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144950_1122144955 -8 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144939_1122144955 17 Left 1122144939 14:99683693-99683715 CCAGCCCGCGGGCCCCGCTGGCG No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data
1122144945_1122144955 5 Left 1122144945 14:99683705-99683727 CCCCGCTGGCGGACCACGGGCGC No data
Right 1122144955 14:99683733-99683755 GTGGACTGTCCGGGCGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144955 Original CRISPR GTGGACTGTCCGGGCGGAGG AGG Intergenic