ID: 1122144957

View in Genome Browser
Species Human (GRCh38)
Location 14:99683742-99683764
Sequence CCCGGGGCGCCTCCTCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144957_1122144968 6 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144968 14:99683771-99683793 GGAGAACAACTTTGGGGGTCTGG No data
1122144957_1122144966 0 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144966 14:99683765-99683787 GCAACTGGAGAACAACTTTGGGG No data
1122144957_1122144970 8 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144970 14:99683773-99683795 AGAACAACTTTGGGGGTCTGGGG No data
1122144957_1122144969 7 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144969 14:99683772-99683794 GAGAACAACTTTGGGGGTCTGGG No data
1122144957_1122144965 -1 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144965 14:99683764-99683786 GGCAACTGGAGAACAACTTTGGG No data
1122144957_1122144973 27 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144973 14:99683792-99683814 GGGGTTCCAAGGAGAAGTTTGGG No data
1122144957_1122144971 16 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144971 14:99683781-99683803 TTTGGGGGTCTGGGGTTCCAAGG No data
1122144957_1122144972 26 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144972 14:99683791-99683813 TGGGGTTCCAAGGAGAAGTTTGG No data
1122144957_1122144964 -2 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144964 14:99683763-99683785 GGGCAACTGGAGAACAACTTTGG No data
1122144957_1122144967 1 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144967 14:99683766-99683788 CAACTGGAGAACAACTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144957 Original CRISPR CCCGGGGCGCCTCCTCCGCC CGG (reversed) Intergenic