ID: 1122144961

View in Genome Browser
Species Human (GRCh38)
Location 14:99683758-99683780
Sequence GTTGTTCTCCAGTTGCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144961_1122144973 11 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144973 14:99683792-99683814 GGGGTTCCAAGGAGAAGTTTGGG No data
1122144961_1122144970 -8 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144970 14:99683773-99683795 AGAACAACTTTGGGGGTCTGGGG No data
1122144961_1122144971 0 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144971 14:99683781-99683803 TTTGGGGGTCTGGGGTTCCAAGG No data
1122144961_1122144969 -9 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144969 14:99683772-99683794 GAGAACAACTTTGGGGGTCTGGG No data
1122144961_1122144968 -10 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144968 14:99683771-99683793 GGAGAACAACTTTGGGGGTCTGG No data
1122144961_1122144972 10 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144972 14:99683791-99683813 TGGGGTTCCAAGGAGAAGTTTGG No data
1122144961_1122144975 20 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144975 14:99683801-99683823 AGGAGAAGTTTGGGAACAGTCGG No data
1122144961_1122144976 30 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144976 14:99683811-99683833 TGGGAACAGTCGGCGTTATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144961 Original CRISPR GTTGTTCTCCAGTTGCCCCG GGG (reversed) Intergenic