ID: 1122144963

View in Genome Browser
Species Human (GRCh38)
Location 14:99683760-99683782
Sequence AAGTTGTTCTCCAGTTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144963_1122144976 28 Left 1122144963 14:99683760-99683782 CCGGGGCAACTGGAGAACAACTT No data
Right 1122144976 14:99683811-99683833 TGGGAACAGTCGGCGTTATGCGG No data
1122144963_1122144972 8 Left 1122144963 14:99683760-99683782 CCGGGGCAACTGGAGAACAACTT No data
Right 1122144972 14:99683791-99683813 TGGGGTTCCAAGGAGAAGTTTGG No data
1122144963_1122144975 18 Left 1122144963 14:99683760-99683782 CCGGGGCAACTGGAGAACAACTT No data
Right 1122144975 14:99683801-99683823 AGGAGAAGTTTGGGAACAGTCGG No data
1122144963_1122144973 9 Left 1122144963 14:99683760-99683782 CCGGGGCAACTGGAGAACAACTT No data
Right 1122144973 14:99683792-99683814 GGGGTTCCAAGGAGAAGTTTGGG No data
1122144963_1122144971 -2 Left 1122144963 14:99683760-99683782 CCGGGGCAACTGGAGAACAACTT No data
Right 1122144971 14:99683781-99683803 TTTGGGGGTCTGGGGTTCCAAGG No data
1122144963_1122144970 -10 Left 1122144963 14:99683760-99683782 CCGGGGCAACTGGAGAACAACTT No data
Right 1122144970 14:99683773-99683795 AGAACAACTTTGGGGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144963 Original CRISPR AAGTTGTTCTCCAGTTGCCC CGG (reversed) Intergenic