ID: 1122144966 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:99683765-99683787 |
| Sequence | GCAACTGGAGAACAACTTTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122144957_1122144966 | 0 | Left | 1122144957 | 14:99683742-99683764 | CCGGGCGGAGGAGGCGCCCCGGG | No data | ||
| Right | 1122144966 | 14:99683765-99683787 | GCAACTGGAGAACAACTTTGGGG | No data | ||||
| 1122144950_1122144966 | 24 | Left | 1122144950 | 14:99683718-99683740 | CCACGGGCGCTAGGCGTGGACTG | No data | ||
| Right | 1122144966 | 14:99683765-99683787 | GCAACTGGAGAACAACTTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122144966 | Original CRISPR | GCAACTGGAGAACAACTTTG GGG | Intergenic | ||