ID: 1122144968

View in Genome Browser
Species Human (GRCh38)
Location 14:99683771-99683793
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144957_1122144968 6 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144968 14:99683771-99683793 GGAGAACAACTTTGGGGGTCTGG No data
1122144950_1122144968 30 Left 1122144950 14:99683718-99683740 CCACGGGCGCTAGGCGTGGACTG No data
Right 1122144968 14:99683771-99683793 GGAGAACAACTTTGGGGGTCTGG No data
1122144961_1122144968 -10 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144968 14:99683771-99683793 GGAGAACAACTTTGGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144968 Original CRISPR GGAGAACAACTTTGGGGGTC TGG Intergenic