ID: 1122144968 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:99683771-99683793 |
Sequence | GGAGAACAACTTTGGGGGTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122144957_1122144968 | 6 | Left | 1122144957 | 14:99683742-99683764 | CCGGGCGGAGGAGGCGCCCCGGG | No data | ||
Right | 1122144968 | 14:99683771-99683793 | GGAGAACAACTTTGGGGGTCTGG | No data | ||||
1122144950_1122144968 | 30 | Left | 1122144950 | 14:99683718-99683740 | CCACGGGCGCTAGGCGTGGACTG | No data | ||
Right | 1122144968 | 14:99683771-99683793 | GGAGAACAACTTTGGGGGTCTGG | No data | ||||
1122144961_1122144968 | -10 | Left | 1122144961 | 14:99683758-99683780 | CCCCGGGGCAACTGGAGAACAAC | No data | ||
Right | 1122144968 | 14:99683771-99683793 | GGAGAACAACTTTGGGGGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122144968 | Original CRISPR | GGAGAACAACTTTGGGGGTC TGG | Intergenic | ||