ID: 1122144970

View in Genome Browser
Species Human (GRCh38)
Location 14:99683773-99683795
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122144963_1122144970 -10 Left 1122144963 14:99683760-99683782 CCGGGGCAACTGGAGAACAACTT No data
Right 1122144970 14:99683773-99683795 AGAACAACTTTGGGGGTCTGGGG No data
1122144961_1122144970 -8 Left 1122144961 14:99683758-99683780 CCCCGGGGCAACTGGAGAACAAC No data
Right 1122144970 14:99683773-99683795 AGAACAACTTTGGGGGTCTGGGG No data
1122144957_1122144970 8 Left 1122144957 14:99683742-99683764 CCGGGCGGAGGAGGCGCCCCGGG No data
Right 1122144970 14:99683773-99683795 AGAACAACTTTGGGGGTCTGGGG No data
1122144962_1122144970 -9 Left 1122144962 14:99683759-99683781 CCCGGGGCAACTGGAGAACAACT No data
Right 1122144970 14:99683773-99683795 AGAACAACTTTGGGGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122144970 Original CRISPR AGAACAACTTTGGGGGTCTG GGG Intergenic