ID: 1122147297

View in Genome Browser
Species Human (GRCh38)
Location 14:99699265-99699287
Sequence TGGGGAAAATGCAGCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 0, 2: 12, 3: 64, 4: 633}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122147297_1122147307 22 Left 1122147297 14:99699265-99699287 CCCTCTGTGCTGCATTTTCCCCA 0: 1
1: 0
2: 12
3: 64
4: 633
Right 1122147307 14:99699310-99699332 TGAAGATAGGGACGATTGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 98
1122147297_1122147306 10 Left 1122147297 14:99699265-99699287 CCCTCTGTGCTGCATTTTCCCCA 0: 1
1: 0
2: 12
3: 64
4: 633
Right 1122147306 14:99699298-99699320 GCTGATGTTACTTGAAGATAGGG 0: 1
1: 0
2: 0
3: 11
4: 204
1122147297_1122147305 9 Left 1122147297 14:99699265-99699287 CCCTCTGTGCTGCATTTTCCCCA 0: 1
1: 0
2: 12
3: 64
4: 633
Right 1122147305 14:99699297-99699319 AGCTGATGTTACTTGAAGATAGG 0: 1
1: 0
2: 0
3: 17
4: 265
1122147297_1122147308 23 Left 1122147297 14:99699265-99699287 CCCTCTGTGCTGCATTTTCCCCA 0: 1
1: 0
2: 12
3: 64
4: 633
Right 1122147308 14:99699311-99699333 GAAGATAGGGACGATTGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122147297 Original CRISPR TGGGGAAAATGCAGCACAGA GGG (reversed) Intronic
900002797 1:24131-24153 TGAGGAAACTGAGGCACAGAAGG - Intergenic
900081002 1:857460-857482 TGGAGAAAATGCAGAACAAGTGG + Intergenic
901245465 1:7726925-7726947 GGGAGAAAATTCTGCACAGAAGG - Intronic
901428028 1:9195755-9195777 TCGGGAAAATGCTGCAGAGCCGG - Intergenic
901657359 1:10777114-10777136 TGGGGAAACTGAGGCCCAGAGGG - Intronic
901722339 1:11209591-11209613 TGGACAAAATGAACCACAGATGG + Intronic
901850396 1:12011332-12011354 TGGGGAAAAGGAGGCCCAGAGGG - Intronic
902115783 1:14119962-14119984 TGAGGAAACTGAGGCACAGATGG + Intergenic
902744605 1:18465103-18465125 TGGGAAAAATGAGGCTCAGAGGG - Intergenic
902923702 1:19682106-19682128 TGGGGAAACTGAGGCTCAGAGGG - Intergenic
903026916 1:20435899-20435921 TGGAGAAACTGGAGCCCAGAGGG - Intergenic
903085595 1:20854998-20855020 TGGGGAAAAGGCAGCAGTGGTGG - Exonic
903562237 1:24236610-24236632 TGGGGAGACAGCAGCACAGAGGG + Intergenic
904267800 1:29327587-29327609 TGGAGAAACTGAGGCACAGAGGG - Intergenic
904282034 1:29427407-29427429 TGAGGAAACTGAGGCACAGAGGG + Intergenic
904566830 1:31433334-31433356 TGGGGAAACTGTAGCAGGGAAGG - Intronic
904618835 1:31763761-31763783 GGGGGAGAATTCAGCAGAGACGG + Intronic
904644426 1:31955201-31955223 TGGGGGAAAGGAATCACAGAAGG + Intergenic
904826730 1:33277971-33277993 CTGGGAAAATGCAGGAGAGAAGG - Intronic
904863577 1:33559167-33559189 TAGGGAAGATGGAGCAGAGAAGG - Intronic
904928443 1:34066725-34066747 TGGGTACACTGCAGCACAGTAGG + Intronic
905174887 1:36129000-36129022 TGGGAAAACTGAGGCACAGAGGG + Intergenic
905348832 1:37330473-37330495 TGAGGAAACTGAAGCTCAGAGGG + Intergenic
906418302 1:45640306-45640328 TGAGGTGAATGCAGCAGAGAAGG + Exonic
907422005 1:54353933-54353955 GGAGGAGACTGCAGCACAGAGGG + Intronic
907811362 1:57873718-57873740 TGAGGAAACTGAGGCACAGAGGG - Intronic
910235194 1:85028378-85028400 TGGGGAAACTGCATCATAGCAGG + Intronic
910557199 1:88547834-88547856 TTGGGAAAATGCACCTTAGATGG - Intergenic
910727630 1:90355539-90355561 TGAGGAAACTGAGGCACAGAGGG - Intergenic
911088019 1:93995762-93995784 TGGGGAATAAGGAGCAGAGAAGG - Intronic
911113924 1:94223399-94223421 TGAGGAAACTGAGGCACAGAGGG - Intronic
911506697 1:98761748-98761770 TGGGGAAACTGAAGTTCAGAAGG - Intergenic
912624660 1:111197275-111197297 TGGGGAGGCTGCAGCACTGAAGG - Intronic
912842063 1:113047626-113047648 TGAAGAAAATGAGGCACAGAGGG + Intergenic
912954533 1:114145342-114145364 TGTGGAAACTGAGGCACAGAAGG + Intronic
913091713 1:115480610-115480632 TGGGGAAACTGAGGCTCAGAGGG - Intergenic
915259124 1:154663278-154663300 TGGGGAAACTGAAGCTCAGGTGG - Intergenic
915583233 1:156828777-156828799 TGGGGAAAATGAGGCTCAGAGGG - Intronic
915681647 1:157587192-157587214 TGGGGACTATGTAGCAGAGATGG - Intronic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
917651857 1:177085623-177085645 TTGGCAAAATGCAGCCCAGGTGG + Intronic
918034641 1:180855856-180855878 TGGGGAAAATACAGTAAAAAGGG - Intronic
918072548 1:181143509-181143531 TGGGGAAATTGGAGGACAGGGGG + Intergenic
918312070 1:183292085-183292107 GGGGGAAATTACAGCACAAATGG + Intronic
918639223 1:186818443-186818465 TGGGGAAAATGAGGAAAAGAGGG + Intergenic
919045046 1:192440807-192440829 TGGGAAAAATAAAGCAGAGAGGG + Intergenic
919347473 1:196403389-196403411 TGGGGAAAAGAAAGGACAGAAGG + Intronic
920009097 1:202854896-202854918 TGGGGAAAGTGCGGATCAGAAGG - Intergenic
920168990 1:204058086-204058108 TGTGGAAAATGAGGCAAAGATGG - Intergenic
920356322 1:205375909-205375931 TGGAGCAAAAGCAGCAGAGAAGG - Intergenic
921086560 1:211799424-211799446 TGAGGAAAATGAGGCACAAAAGG + Intronic
921656070 1:217738581-217738603 TGAGGATATTGCAGCCCAGAGGG + Intronic
922154690 1:223031727-223031749 TGGTTAAAAAGCAGCAGAGAAGG + Intergenic
922237799 1:223734872-223734894 TGAGGAAACTGAGGCACAGAGGG + Intronic
923009956 1:230080765-230080787 TGGGGAAACTGAGGCACTGAAGG - Intronic
923070935 1:230563741-230563763 TGGGAAAAAGGCAGCTCAGAGGG + Intergenic
924208615 1:241742236-241742258 TGGAGGAAATGCAGCAGAAAGGG - Intronic
924594168 1:245430803-245430825 CGTGGAAACTGAAGCACAGAGGG + Intronic
924933938 1:248752302-248752324 TGAGAAACCTGCAGCACAGAGGG + Intronic
1063171441 10:3513417-3513439 TGTGGAAACTGCAACTCAGAGGG - Intergenic
1064086644 10:12350191-12350213 TGGGGAGAAGGCAGCGGAGAGGG - Intronic
1066698991 10:38106383-38106405 TGGGGAGAAACCAGCACAAAAGG + Intronic
1067226733 10:44381495-44381517 TGGGGAAAGTGCTGGGCAGAAGG - Intronic
1067553650 10:47252985-47253007 TGGGGAAAATGAGGCACAGAAGG + Intergenic
1067788500 10:49270564-49270586 TGAGGAAAATGAAGCCCAGAGGG + Intergenic
1068764863 10:60751977-60751999 TGGGGAAAAGGTACCAGAGATGG - Intergenic
1069047808 10:63761614-63761636 TGAGAAATATCCAGCACAGAGGG - Intergenic
1069366125 10:67695631-67695653 TGGGGAAAAGGAAGCAAAGATGG - Intronic
1070045567 10:72831658-72831680 GGGGGAAAATACAGCATAAAAGG + Intronic
1071305627 10:84296591-84296613 CGAAGAAAATGCATCACAGAAGG - Intergenic
1071611805 10:87038675-87038697 TGGGGAAGATGCAGTGTAGAAGG + Intergenic
1072128418 10:92468212-92468234 GGGGGAAAAGGCAGCACAGATGG + Intronic
1072569146 10:96643373-96643395 TGGGGAAACAGAGGCACAGAGGG - Intronic
1072799562 10:98383824-98383846 TGGGCGAAATGCAGCACATGTGG - Exonic
1073187082 10:101621715-101621737 TGAGGAAACTGAAGCTCAGAGGG + Intronic
1073490362 10:103849282-103849304 TGGGGAAATTGAAGCTCGGAGGG - Intronic
1073817326 10:107222430-107222452 TGTGGAGAAGGCATCACAGATGG - Intergenic
1073990696 10:109259144-109259166 TGAGGAAACTGAAGCCCAGATGG - Intergenic
1074206903 10:111290514-111290536 TGGGGGAAAGGGAGCAAAGATGG + Intergenic
1074853878 10:117459179-117459201 TGGGGAAATTGGAGCCCAGATGG + Intergenic
1074892271 10:117745594-117745616 TGGGGAAACTGAGGCTCAGAAGG + Intergenic
1075623971 10:123948480-123948502 TGGGAAAACTGAAGCAAAGATGG + Intergenic
1075664546 10:124221261-124221283 TGGGGAGAATGAAGCTCAGAAGG - Intergenic
1075726712 10:124614312-124614334 TGGGGAAACTGAGGCCCAGAGGG + Intronic
1076480984 10:130785197-130785219 TGGGGAAAGGGCAGGAGAGAAGG - Intergenic
1076838660 10:133033763-133033785 GGGAGAAAATGTAGCAAAGAGGG + Intergenic
1076867293 10:133174302-133174324 TGGGGAACTTGCAACACGGAAGG + Intronic
1076867318 10:133174413-133174435 TGGGGAACTTCCAACACAGAAGG + Intronic
1077029689 11:459411-459433 TGAGGAAACTGAGGCACAGAGGG + Intronic
1077448407 11:2615977-2615999 TGAAGAAAATGCTACACAGATGG - Intronic
1078032159 11:7763919-7763941 TGGTGAAAAAGCAGGGCAGAAGG + Intergenic
1078461811 11:11520262-11520284 TGGGAAAACTGAGGCACAGAGGG + Intronic
1079243219 11:18735348-18735370 TGGGGGACCTGCAGCAGAGAGGG + Intronic
1079244044 11:18740425-18740447 TGAGGAAACTGAAGCTCAGAGGG + Intronic
1079473807 11:20807625-20807647 AGGGGAACTTGCTGCACAGAAGG - Intronic
1079936858 11:26627494-26627516 TGAAGAAAATGCAGCTCAGAGGG - Intronic
1080604796 11:33856092-33856114 CAAGGAAAATGAAGCACAGATGG - Intergenic
1080613367 11:33924833-33924855 TGGGGAAACTGAGGCCCAGAGGG + Intergenic
1081340541 11:41922064-41922086 TGGTGGAAATGAAGCAAAGAAGG - Intergenic
1081821020 11:45994894-45994916 TAAGGAAAATGCAGCACAGAGGG - Intronic
1082133727 11:48523194-48523216 TGTGGAAAGTGCATCACAGCTGG + Intergenic
1082566746 11:54689584-54689606 TGTGGAAAGTGCATCACAGCTGG + Intergenic
1082928067 11:58571995-58572017 TGAGGAAACTGCATCAGAGAAGG - Intronic
1083268779 11:61560110-61560132 TGGGGAAACTGAGGAACAGAGGG + Intronic
1084035586 11:66508051-66508073 TCTGGAAAATGAGGCACAGAGGG + Intronic
1084264808 11:67999399-67999421 TGGGGAAACTGAGGCCCAGAGGG + Intronic
1084270689 11:68027643-68027665 TGGGGAAACTGAGGCTCAGAGGG + Intronic
1084386495 11:68846111-68846133 TGAGGAAACTGAGGCACAGATGG - Intergenic
1085303425 11:75471954-75471976 TGGGAAAAATAAAGCTCAGAGGG + Intronic
1085317449 11:75554208-75554230 TGGGGAAACTGAGGCTCAGAGGG + Intergenic
1085331865 11:75658860-75658882 TTGGGAAAATTCAGTAGAGAGGG - Intronic
1085476157 11:76790172-76790194 TGGAGAAACTGAGGCACAGAAGG + Intronic
1086117920 11:83272975-83272997 TTTGGAAAATGAAGCACAGAGGG - Intronic
1086754227 11:90538719-90538741 TGGGGAGGATACAGCACAGCAGG - Intergenic
1087239393 11:95757904-95757926 TGAGGAAACTGAAGCTCAGAGGG + Intergenic
1087357491 11:97113010-97113032 TTGAGAAAATACTGCACAGAGGG - Intergenic
1087914854 11:103798274-103798296 TGGGGAAAGTAAAGAACAGATGG + Intergenic
1089069974 11:115692353-115692375 TGGGGAAACTGAGGCTCAGAGGG - Intergenic
1089728485 11:120504092-120504114 TGGGTAAACTTCAGCACACACGG - Intergenic
1090000913 11:122957081-122957103 TTGGGTAAATGCAACAAAGAAGG + Intronic
1090160358 11:124486808-124486830 TGTAGAACATGCAACACAGAAGG + Intergenic
1090415741 11:126539116-126539138 TGGGGAAACTGAGGCTCAGAGGG - Intronic
1090423490 11:126591482-126591504 TGAGGAAATGGCAGCTCAGAGGG + Intronic
1090864151 11:130681691-130681713 TGGAGAAAATCCAGAACAGTGGG + Intronic
1091446538 12:546894-546916 TGGGGAAACTGAGGCCCAGAAGG + Intronic
1091454561 12:597240-597262 TGGGGAGACTGAGGCACAGAAGG - Intronic
1091760677 12:3085262-3085284 TGGGGGACATGCCGCACAGCAGG - Intronic
1091974354 12:4812581-4812603 TGGGGAAAATGAAGGAGAAAAGG - Exonic
1092558450 12:9582639-9582661 TGAGGAAACTGAAGCATAGAGGG + Intergenic
1092721874 12:11449225-11449247 TGGAGAAAATGAGGCAAAGAGGG - Intronic
1092847188 12:12594861-12594883 TGGGGTAATTCCAGCACTGAGGG + Intergenic
1093652444 12:21660922-21660944 TGGGGAAAAAGGAGAACTGAGGG + Intronic
1093652907 12:21664358-21664380 TGGGGAAACTGAATCACAGAAGG + Intronic
1094451431 12:30586599-30586621 TGAGGAAATTGAGGCACAGAAGG - Intergenic
1095351777 12:41222117-41222139 TATGGAAAAGGCAGTACAGAGGG - Intronic
1095921766 12:47539093-47539115 TGGGCAGAAGGCAGCACAGTGGG + Intergenic
1095941595 12:47730875-47730897 GGGGGAAATTGAGGCACAGAGGG - Intergenic
1096220336 12:49825098-49825120 TGGGGAAACTGAAGTCCAGAGGG - Intronic
1096879238 12:54653948-54653970 TGGGGAATGTGGAACACAGAGGG + Intergenic
1097155841 12:57011729-57011751 TGAGGAAACTGAAGCACAGGAGG + Intronic
1097715697 12:62963490-62963512 TGAGGAAACTGCAGCCCAGAGGG + Intergenic
1099008032 12:77258975-77258997 TGGGGAAAATGAGGCATATAAGG + Intergenic
1099876957 12:88419440-88419462 TGGAGAAAATGAAGCAGGGAAGG - Intergenic
1100364284 12:93904878-93904900 TGGAGAAAATAAAACACAGAAGG - Intergenic
1100752508 12:97714529-97714551 TGAGGAAACTGAAGCTCAGAAGG + Intergenic
1100984104 12:100188442-100188464 AGAGGAAAATGCAGCAGGGAGGG + Intergenic
1101753373 12:107601700-107601722 TAAGGAAAATGGGGCACAGAGGG - Intronic
1101838514 12:108311661-108311683 AGGGGAAAAGGCAGCATAGAGGG + Intronic
1101927156 12:108981641-108981663 TGAGGAAACTGAAGCACAGAAGG - Intronic
1102024068 12:109703540-109703562 TGGGGAAACTGAGGCTCAGAGGG + Intergenic
1102259938 12:111437567-111437589 TGAGGAAACTGAAGCACAGCAGG + Intronic
1102323598 12:111958891-111958913 TGGGGAAAATGGAACCAAGATGG + Intronic
1102561703 12:113766810-113766832 TGGGGAAACTGAGGCACAGAGGG - Intergenic
1102563998 12:113782868-113782890 TGGGGAAACTGAGGCCCAGAGGG + Intergenic
1102979092 12:117227386-117227408 GGGGGAAAATGCAGCTGAGGAGG + Intronic
1103700423 12:122846325-122846347 TGAGGAAACTGAGGCACAGAAGG - Intronic
1103939003 12:124491882-124491904 TGGAGAGAATGAGGCACAGAGGG + Intronic
1104213396 12:126712279-126712301 TGGGGAAAAGGTAGGAAAGATGG + Intergenic
1104423200 12:128653924-128653946 AGGGGAAACTGAGGCACAGAGGG - Intronic
1105786229 13:23752051-23752073 TGTGGGCAAGGCAGCACAGAGGG + Intronic
1105962906 13:25358273-25358295 GGGGGAAAATGCAGAATCGAGGG + Intergenic
1106154056 13:27135832-27135854 AGGGGAGAAGGCAGCAAAGAAGG + Intronic
1106809385 13:33345159-33345181 TGGGCAGAATGAACCACAGAGGG + Intronic
1107372621 13:39768996-39769018 TGGGGAAAAAACATTACAGAAGG - Intronic
1108028401 13:46202750-46202772 TATGGAAAATTAAGCACAGAAGG - Intronic
1108533027 13:51345190-51345212 TGGAGAAACTGAGGCACAGAAGG + Intronic
1109133586 13:58619573-58619595 TGGGGAACACACAGTACAGATGG + Intergenic
1109678239 13:65709595-65709617 TGAGGAAACAGAAGCACAGAGGG - Intergenic
1109705214 13:66080995-66081017 TGGGCAAAAGTCATCACAGAAGG - Intergenic
1110470598 13:75855482-75855504 TGACTCAAATGCAGCACAGATGG - Intronic
1110682342 13:78330313-78330335 TGAGGAAAATGCACCCCAAAAGG - Intergenic
1111079649 13:83286219-83286241 TGCGGAAAAGGGACCACAGATGG - Intergenic
1111981191 13:95017115-95017137 TAGTGAAAATGCAGAAAAGAGGG - Intergenic
1112127292 13:96481997-96482019 TGGAGTTAATGAAGCACAGAAGG - Intronic
1112163623 13:96894789-96894811 TGTGGACAATGCATCATAGATGG + Intergenic
1112344517 13:98577811-98577833 AGGGGAAAATGGGGCGCAGAGGG + Intronic
1113103891 13:106751389-106751411 TGAGGAAATTGTGGCACAGAGGG - Intergenic
1113291071 13:108906808-108906830 TAGGAAAAATGAAGCCCAGAGGG + Intronic
1113583732 13:111448626-111448648 TGGGGAAACTGAGGCCCAGAGGG + Intergenic
1115646037 14:35369093-35369115 CGGGGAAAACGCTGCAGAGATGG + Intergenic
1115707518 14:36014080-36014102 TTGGGATAATGCAGCTGAGACGG - Intergenic
1115905674 14:38200381-38200403 TGAGGAAAATGAAGCACAGAGGG + Intergenic
1116433502 14:44872909-44872931 TGGGGAGAAACCAGCACAGAAGG - Intergenic
1117502245 14:56364674-56364696 TGAGGAAAAACCAGCACAAAAGG - Intergenic
1117552396 14:56849393-56849415 TGGGGAAAAGGCAGCAGAGCAGG - Intergenic
1117744015 14:58849036-58849058 TGGGTAAAATGAGGCACAGGGGG + Intergenic
1118050750 14:62024546-62024568 GGGGGAAAATGGAGAACACAGGG - Intronic
1118105405 14:62653497-62653519 TAAGGAAAATGAAGCTCAGAGGG + Intergenic
1118179112 14:63473362-63473384 AGGGGAAAACGAAGAACAGAAGG + Intronic
1118242051 14:64069521-64069543 TGGGGAAAAAGCACCGCAGCAGG - Intronic
1118310114 14:64685843-64685865 TGTGGAGCATGCAGCGCAGAGGG + Intergenic
1118741605 14:68743581-68743603 TGGGGAAAACCCTGCACAGTGGG - Intergenic
1118883572 14:69848967-69848989 TGGGGAAATTGAGGCGCAGAGGG + Intergenic
1118915003 14:70095420-70095442 TGGAGAAACTGAGGCACAGAAGG - Intronic
1119087380 14:71750780-71750802 TGAGGAAGCTGCAGCTCAGAAGG + Intergenic
1119765153 14:77183162-77183184 TGAGGAAACTGAGGCACAGAGGG + Intronic
1119899401 14:78247109-78247131 TGGAGATAATGGACCACAGAAGG - Intronic
1119936448 14:78596409-78596431 TGGGGAAGCCACAGCACAGAGGG - Intronic
1120104467 14:80478586-80478608 TGAGGAAATTGCAGGACAGTGGG - Intronic
1120148155 14:81002392-81002414 TGGGGAAACTGAAGCACAGACGG - Intronic
1120486182 14:85116072-85116094 TGGAGGAACTCCAGCACAGACGG - Intergenic
1121064297 14:90946925-90946947 TGGGGACAATGGAGGAGAGAGGG + Intronic
1121341839 14:93110063-93110085 TGAGGAAAGTGAGGCACAGAGGG + Intronic
1121494653 14:94383816-94383838 CAGGGAAACTGCTGCACAGAAGG + Intronic
1121984672 14:98493156-98493178 TGAGGAAACTGAGGCACAGAGGG + Intergenic
1122039001 14:98968958-98968980 TGGGGAAACTGAGGCACACAGGG + Intergenic
1122147297 14:99699265-99699287 TGGGGAAAATGCAGCACAGAGGG - Intronic
1122290809 14:100679523-100679545 TGGGGAAACTGAGGCCCAGAGGG + Intergenic
1122533408 14:102445113-102445135 TGTGGAGCATGCAGCACTGAGGG + Intronic
1122665209 14:103324976-103324998 TGAGGAAACTGAGGCACAGAGGG - Intergenic
1124432491 15:29619453-29619475 TGGGGAAACTGAAACACTGAGGG + Intergenic
1125332472 15:38595650-38595672 TGAGGACACTGAAGCACAGATGG - Intergenic
1125434904 15:39634165-39634187 TGGGAAAAATCCAGTAGAGAGGG - Intronic
1126097416 15:45099402-45099424 TGGGGAATATGCAGGCCAGCAGG + Exonic
1126910644 15:53413905-53413927 TGGGGAAACTGTAGCTTAGAGGG + Intergenic
1127018370 15:54715401-54715423 TGGTGAAAATGAGGTACAGAGGG - Intergenic
1127322236 15:57858053-57858075 TGGGGAGACTGCACCAGAGAAGG - Intergenic
1127717426 15:61662873-61662895 TGAGGAAACTGAGGCACAGAGGG + Intergenic
1127754995 15:62083545-62083567 GGAGGAAAATACAGAACAGATGG + Intergenic
1128108643 15:65062359-65062381 TGGGGAAACCACAGCTCAGAGGG + Intronic
1128241310 15:66103027-66103049 TGAGGAAACTGAGGCACAGAGGG + Intronic
1128343117 15:66836513-66836535 TGAGGAAACTGAAGCCCAGAGGG + Intergenic
1128871210 15:71156580-71156602 TAGGGGAAATTCAGGACAGAAGG + Intronic
1129898611 15:79128255-79128277 GGGGAAAAATGTAGCATAGATGG + Intergenic
1130097062 15:80863770-80863792 TGATGGAAATGCAGCACATAGGG - Intronic
1130885364 15:88088163-88088185 TGGGGAAACTGAGGCCCAGAAGG - Intronic
1131265484 15:90912834-90912856 TGTTGAAACTACAGCACAGAGGG - Intronic
1131661178 15:94519137-94519159 TGAGGAAACTGAGGCACAGATGG + Intergenic
1131998617 15:98157822-98157844 TGGGGAAATTGAAGCTCAGCAGG - Intergenic
1132704438 16:1237058-1237080 TGGGGAAACTGAGGCAGAGAGGG - Intergenic
1132707078 16:1249367-1249389 TGGGGAAACTGAGGCAGAGAGGG + Intergenic
1133315161 16:4878397-4878419 TGGGAGACGTGCAGCACAGAGGG - Intronic
1133415432 16:5603343-5603365 TGGGGAAACTGAGGCTCAGAAGG + Intergenic
1133605569 16:7384558-7384580 TGGGAAAAATAAAGCCCAGATGG - Intronic
1133711947 16:8409855-8409877 TGAGGAAAATGAGGCACAGAGGG - Intergenic
1134098386 16:11434759-11434781 TGGAGAAACTGAGGCACAGAAGG + Intronic
1134372459 16:13638099-13638121 TGAGGAAAATGCAAGGCAGAAGG - Intergenic
1134446596 16:14335960-14335982 TGGGGAAACTGAGGCTCAGAAGG + Intergenic
1134677149 16:16098716-16098738 TGGGGAAACTGACGCACAAATGG + Intronic
1134684812 16:16150989-16151011 TGGGGAAACTGAGGCACAAAGGG - Intronic
1134794668 16:17024108-17024130 TGGGAAAAATAAAGCCCAGATGG + Intergenic
1134820952 16:17246978-17247000 TGGGGAGACAGCATCACAGAAGG + Intronic
1135421004 16:22305509-22305531 TGAGGAAAGTGAGGCACAGAAGG - Intronic
1135779615 16:25288852-25288874 TGAGGAAACTGAAGCACAGAGGG - Intergenic
1135814096 16:25616268-25616290 TGGGGAAACTGAGGCACAGAGGG + Intergenic
1136029962 16:27495699-27495721 TGCAGAAAATAAAGCACAGATGG + Intronic
1136402775 16:30027619-30027641 AGGGGAAAATGCAGAGCAAAAGG + Intronic
1137752437 16:50876789-50876811 TGGGGAAACTGAGGCCCAGAGGG + Intergenic
1137764958 16:50970905-50970927 TGAGGAAACTGCAGTTCAGAGGG - Intergenic
1138080286 16:54084201-54084223 TGAGGAAACTGAAGCTCAGAAGG - Intronic
1138312658 16:56041367-56041389 TGGGGAAACTGAGGCCCAGAAGG - Intergenic
1138454576 16:57113967-57113989 TGGGGAAACTGAGGCCCAGAGGG - Intronic
1138482035 16:57309822-57309844 TGGGGAAAGTGCAATAAAGAGGG + Intergenic
1139144370 16:64306881-64306903 TGGGGAGAAGGAAGGACAGAAGG + Intergenic
1139159823 16:64491095-64491117 TAGGGCAAATAAAGCACAGAGGG + Intergenic
1139159882 16:64491693-64491715 TAGGGCAAATACAGCACAGAGGG + Intergenic
1139219360 16:65164328-65164350 AGGGGGAAAAGGAGCACAGAAGG - Intergenic
1139341185 16:66269114-66269136 TGAGGAAACAGAAGCACAGAAGG + Intergenic
1139351947 16:66342530-66342552 CAGGGAAACTGCAGCCCAGAGGG - Intergenic
1141150708 16:81562801-81562823 TGTGGAAACTGAAGCTCAGAAGG + Intronic
1141190065 16:81818183-81818205 TGAGGAAACTGAGGCACAGAGGG - Intronic
1141749156 16:85946743-85946765 TGTGGATAATGGAGCACAGCAGG - Intergenic
1141750924 16:85957366-85957388 TGGGGAAACTGAGGCTCAGAGGG + Intergenic
1141894138 16:86947613-86947635 TGGGGAAACTGAGGCACAGGGGG + Intergenic
1142118713 16:88375300-88375322 TGGGGAAACTGAGGCACAGAGGG + Intergenic
1142362403 16:89633644-89633666 TGGGGAAACTGAGACACAGAGGG + Intronic
1142362413 16:89633710-89633732 TGGGGAAACTGAGACACAGAGGG + Intronic
1142608170 17:1093637-1093659 TGCTGAAAATGCTGCACTGAAGG + Intronic
1143043536 17:4057811-4057833 TGAGGAAACTGAGGCACAGAGGG + Intronic
1143275143 17:5704851-5704873 TAAGGAAACTGCGGCACAGAAGG - Intergenic
1144154355 17:12484476-12484498 TGAGGAAATTGCAGCACAGATGG + Intergenic
1144439952 17:15272506-15272528 TGGGGAAAATCCTTCACAGCTGG - Intergenic
1144774396 17:17777747-17777769 TGGGGAAACTGAGGCCCAGAGGG + Intronic
1144801009 17:17927279-17927301 TGTGGATAAAGCAGCACAGCTGG + Intronic
1144846947 17:18225171-18225193 TGGGGAAACTGAGGCGCAGAGGG + Intergenic
1145270377 17:21401592-21401614 TGGGGAAACTGAGGCCCAGAGGG + Intronic
1145746316 17:27322843-27322865 TGAGGAAACTGAGGCACAGAGGG + Intergenic
1145766608 17:27462218-27462240 TGAGGGAATTGCAGCTCAGAGGG + Intronic
1146489947 17:33273713-33273735 TGGGGAAATTGAGGCACAGAAGG + Intronic
1146568782 17:33935657-33935679 TGAGGAAACTACAGCTCAGAGGG + Intronic
1146909130 17:36636994-36637016 TGGGGAAACTGAGGCTCAGAAGG - Intergenic
1148330874 17:46813268-46813290 TAAGGAAAATGAAGCCCAGAAGG + Intronic
1148796071 17:50197469-50197491 TGGGGAAATTGGTGCGCAGATGG - Intronic
1149126077 17:53235047-53235069 TGGGGAACCTGAAGCACAAAGGG - Intergenic
1149485404 17:57038813-57038835 TGGAGAACATGAAGCAAAGAAGG + Intergenic
1149766807 17:59285899-59285921 TGGGGAAATAGAAGCTCAGATGG + Intergenic
1150594359 17:66591052-66591074 TGTGGAAAATGCGGTACAGGGGG - Intronic
1150715673 17:67570671-67570693 TGAGGAAACTGAAGCTCAGAGGG + Intronic
1151329822 17:73400189-73400211 TGGGGAAACTGAGGCACAGAGGG + Intronic
1151930644 17:77229664-77229686 TGGGGAAACTGAGGCTCAGAGGG + Intergenic
1153668467 18:7387426-7387448 TGAGGAAACTGAGGCACAGAGGG - Intergenic
1153896814 18:9570279-9570301 GGGGGAAAACCCAGCCCAGAGGG - Exonic
1155380028 18:25210641-25210663 TTTGGAAAATGAAGCAAAGAAGG - Intronic
1155554676 18:27005666-27005688 TGAGGAAACTGAGGCACAGAGGG + Intronic
1155966572 18:32041061-32041083 TGGGCAAAATGAAGCAGAGTGGG + Intronic
1156351252 18:36303192-36303214 TGGGGAAACTGAGGCACAGGAGG + Intronic
1156613287 18:38752407-38752429 TAGGGAAACTGCTGCAGAGAAGG + Intergenic
1156962558 18:43050628-43050650 TGGGGCAGATGGAGGACAGAAGG - Intronic
1158105827 18:53884083-53884105 TGGTGAAAATGAAGCAGAAATGG - Intergenic
1158626670 18:59077628-59077650 TGGGGAAAAAGCAGCACATTTGG - Intergenic
1158712343 18:59848726-59848748 TGGGGATATTGAAGCACAGAGGG - Intergenic
1160175959 18:76594402-76594424 TGAGGAAACTGAGGCACAGAAGG + Intergenic
1160372605 18:78387174-78387196 TGGGGAAAAGGGTGCACACATGG - Intergenic
1160634548 19:65739-65761 TGAGGAAACTGAGGCACAGAAGG - Intergenic
1160742948 19:695704-695726 TGGGTAAACTGAGGCACAGAAGG - Intergenic
1160924094 19:1534868-1534890 TGGGGAAACTGAGGCTCAGATGG - Intronic
1160990710 19:1859242-1859264 TGGGGAAACTGAGGCCCAGAGGG - Intronic
1161076096 19:2286517-2286539 TGGGGAAACTGAGGCACAGTGGG - Intronic
1161243098 19:3233864-3233886 TGGGGAAACTAAGGCACAGAAGG + Intronic
1161313787 19:3608645-3608667 TGGGGAAACTGAGGCACAAAGGG + Intergenic
1161719458 19:5895018-5895040 TGTGGAAACTGATGCACAGAGGG + Intronic
1162536016 19:11262952-11262974 TGGGGAAACTGAAGCTCAGGAGG + Intergenic
1162828637 19:13270177-13270199 TGAGGAAACTGCGGCCCAGAGGG - Intronic
1162894908 19:13759375-13759397 TGGGGAAACTGAGGCTCAGAGGG - Intronic
1163122348 19:15225614-15225636 TGGGGATAAGGGAGGACAGAGGG + Intergenic
1163432097 19:17274321-17274343 TGGGGAAACTGAGGCTCAGAGGG - Intronic
1163453834 19:17394360-17394382 GGGGGAAATTGAGGCACAGAGGG - Intergenic
1164146360 19:22514897-22514919 TGGGGAAACTGAGTCACAGAGGG + Intronic
1164560662 19:29289862-29289884 TGGGGAAAATGAGACTCAGAGGG - Intergenic
1164822517 19:31261093-31261115 TGGGGAGATTGAAGCACAGGAGG - Intergenic
1165604947 19:37093810-37093832 TGGGGAAGAGGTAGAACAGATGG + Intronic
1166125028 19:40709968-40709990 TGAGGAAACTGGAGCTCAGAGGG + Intronic
1166165148 19:40982514-40982536 TGGAGAAAGTGAAACACAGAGGG - Intergenic
1166445552 19:42855124-42855146 AGGGGAAAATACACCAGAGAGGG - Intronic
1166448552 19:42879092-42879114 AGGGGAAAATACACCAGAGAGGG - Intronic
1166452950 19:42917288-42917310 AGGGGAAAATACACCAGAGAGGG - Intronic
1166455440 19:42936586-42936608 AGGGGAAAATACACCAGAGAGGG - Intronic
1166492117 19:43268954-43268976 AGGGGAAAATACACCAGAGAGGG - Intronic
1166868934 19:45858852-45858874 TGGAGAAAAAGCAACACAGATGG - Intronic
1166887318 19:45969989-45970011 TGGGGAAACTGAGGCTCAGAGGG - Intronic
1166889093 19:45979402-45979424 TGGGGAAAATGCAGCAGGGGAGG + Intergenic
1166988914 19:46678827-46678849 TGGGGAAACTGAGGCACAGAGGG - Intronic
1167006895 19:46782177-46782199 TGAGGAAACTGAAGCAGAGAAGG + Intronic
1167469085 19:49665507-49665529 TGGGGAAAGTGGAGCAAGGAAGG - Exonic
1167659821 19:50790158-50790180 TGGGGAAACTGAGGCACAGAAGG - Intergenic
1168294458 19:55372085-55372107 TGAGGAAACTGAGGCACAGAGGG - Intergenic
925052954 2:831306-831328 TTGGGACAATGGAGAACAGAGGG - Intergenic
925205066 2:1998518-1998540 TGGGGAAAATTAAGTACACAAGG - Intronic
925307294 2:2857939-2857961 TGAGGAAAGTGCAGAATAGAAGG + Intergenic
925631524 2:5898750-5898772 TGAGGAAACTGAGGCACAGAGGG + Intergenic
926013576 2:9427789-9427811 TTGGGAAAAGGCATCAAAGAAGG + Intronic
926337188 2:11872749-11872771 TGGGAAAAATGAGGCACAGAGGG - Intergenic
926692271 2:15745754-15745776 TGGAGAAACTGAGGCACAGAGGG + Intergenic
926811342 2:16757625-16757647 TGGGCAAACTGCAGTCCAGAGGG + Intergenic
926961314 2:18361575-18361597 TGGGGAACCTGGAGCATAGAGGG + Intronic
926969160 2:18449724-18449746 TGGGGTAAGTGAGGCACAGATGG - Intergenic
927214318 2:20658497-20658519 TGGAGAAATTGGAACACAGATGG - Intergenic
927508494 2:23629671-23629693 TGCTGAAAGTGCAGCACAGATGG - Intronic
927844453 2:26464237-26464259 TGGGGAAACTGAGGCACAGAAGG + Intronic
927882370 2:26697764-26697786 TGGGGAAAGAGCGGAACAGAAGG - Intronic
928234476 2:29527861-29527883 TGGGGAACATGAAGCCCAGGCGG - Intronic
928756277 2:34529417-34529439 GGGGGAAAATGCAGAAGAGGTGG + Intergenic
929022522 2:37567708-37567730 TGGGGAAAATGCTACACAGGAGG + Intergenic
929023175 2:37574495-37574517 TGGGGAAAATGCTACACAGGAGG + Intergenic
929256026 2:39812777-39812799 TGAGGAAAAACCAGCACAAAAGG - Intergenic
930121191 2:47762135-47762157 TGGGGAATTTCCAGAACAGAGGG + Intronic
930899837 2:56491653-56491675 TGGAGAAAATTAAGCACAGGCGG + Intergenic
931605976 2:64052378-64052400 TGAGGAAACTGTAGCAGAGAGGG + Intergenic
931782328 2:65589587-65589609 TGGGGAAAATGTGGCAGAAATGG + Intergenic
931937638 2:67215785-67215807 AGGGGAAAATGACGCACGGAAGG - Intergenic
932051930 2:68406235-68406257 TGAGGAAAAACCAGCACAAAAGG + Intergenic
932426028 2:71635884-71635906 TGGAGAAAAAGCAACAAAGAGGG + Intronic
932504419 2:72214953-72214975 GGGAGGAAATGCAGCAAAGAGGG + Intronic
932968334 2:76505425-76505447 TGAGGAAAGTGGAGTACAGAGGG + Intergenic
933318652 2:80745180-80745202 TTGGTAAAATGCAGAACTGATGG + Intergenic
933833739 2:86230068-86230090 GGGGCATAATGCAGCACAGCTGG + Intronic
934476560 2:94597439-94597461 TTGGGAAGATGCTGCACATAAGG - Intronic
934695107 2:96394233-96394255 TGGGGACAATCCATCCCAGAAGG - Intergenic
935039508 2:99412326-99412348 TTGGAAAGCTGCAGCACAGATGG - Intronic
935211988 2:100946221-100946243 TGAGGAAAATGCAGCATGGAGGG + Intronic
935262866 2:101370122-101370144 TGAGGAAACTGAGGCACAGAGGG - Intronic
935325099 2:101928663-101928685 TGGGATAAATCCAGCACATAGGG + Intergenic
936030571 2:109067419-109067441 TGGTGAAAGTACAGCACAGGCGG - Intergenic
936629743 2:114189394-114189416 TTGTGAGAATGAAGCACAGATGG + Intergenic
937071524 2:119067269-119067291 GGGGGAACAGGCAGCACAAAGGG + Intergenic
937927276 2:127176903-127176925 TGGGGAAAATGCAACAGAAGCGG - Intergenic
940796940 2:158090008-158090030 TGGGGAAAATGGAGGATAGGAGG - Intronic
942086522 2:172449148-172449170 TGGGAAGAATGCTGCACAGTGGG + Intronic
942512034 2:176712937-176712959 TGGGAAAACTGAGGCACAGAAGG - Intergenic
943493122 2:188581383-188581405 TGGGGAAAATGGAGCATTGATGG + Intronic
943626249 2:190203777-190203799 TGAGGAAATGGCAGCCCAGAAGG - Intronic
943962968 2:194291014-194291036 TGGGGAAAATGCAACCAGGAGGG - Intergenic
944114588 2:196172612-196172634 TGGGGAAAATGCAGTAGGAAAGG - Intronic
944409159 2:199420167-199420189 TGAGGAAACTGAGGCACAGATGG - Intronic
944513226 2:200484838-200484860 TGGAGAAACTGAAGCACAGAGGG - Intergenic
945185422 2:207134815-207134837 TGAGGAAACTGAGGCACAGAGGG - Intronic
945259914 2:207833770-207833792 AGTGGAAAATGCATCACAGAGGG + Intronic
945971566 2:216236325-216236347 TTGGGAAAATGAAGCACACAGGG + Intergenic
946045314 2:216816129-216816151 TGGGGAAAGAGCAGGAAAGAAGG - Intergenic
946168275 2:217878458-217878480 TGGGGAAACTGGAGCACAGAGGG - Intronic
946242161 2:218363007-218363029 TGGGGAGAAAACAGCACAGGTGG + Intronic
946518119 2:220435545-220435567 TGGGGAGAATGTGGCGCAGAGGG - Intergenic
946918149 2:224548137-224548159 TGGGGAAATTGCAGCCTTGAAGG - Intronic
947696873 2:232198141-232198163 TGGGGAAACTGAGGCCCAGACGG - Intronic
948438784 2:237972055-237972077 AGGGGAACCTGCAACACAGATGG + Intronic
948463213 2:238140117-238140139 TGGGGAGACTGAGGCACAGAAGG - Intronic
1168787857 20:555483-555505 TTGGGAGTATGCAGCACAGTGGG + Intergenic
1168794588 20:603017-603039 TGGGGTAGAGGCAGAACAGAGGG + Intergenic
1169114324 20:3053421-3053443 TGAGGAAACTGAGGCACAGAGGG - Intergenic
1169151067 20:3289812-3289834 TGGAGAAAATAAAGCAGAGAAGG - Intronic
1170404065 20:16018096-16018118 TGGGGAATATGGAGCACAGAAGG + Intronic
1170540500 20:17382692-17382714 TGGGGAGAATGCATTGCAGAGGG - Intronic
1170683434 20:18547249-18547271 TGAGGAAACTGAGGCACAGAGGG - Intronic
1171131504 20:22657961-22657983 TGAGGAAAATGAGGCTCAGAAGG + Intergenic
1171277113 20:23867025-23867047 TGGGGGAGATGCAACAGAGAAGG - Intergenic
1172055756 20:32153146-32153168 TGGGGAAACTGAAGCTCAGAGGG - Intronic
1172687677 20:36768777-36768799 TGGGAAAACTGCAGCTCTGAGGG + Intronic
1173606013 20:44332225-44332247 TGAGGAAACTGAGGCACAGAAGG + Intergenic
1174142594 20:48426333-48426355 TTGGGAAAATGCAGGAAACAAGG - Intergenic
1174169860 20:48609511-48609533 TGAGGAAACTGAAGCCCAGAAGG - Intergenic
1174253639 20:49237905-49237927 TGGGGGATATGAAGCAGAGAAGG + Intronic
1174272668 20:49380889-49380911 TAGGGAAACTGAGGCACAGAGGG - Intronic
1174396049 20:50247473-50247495 TGGGGAAACTGAAGCACAGAGGG + Intergenic
1174404224 20:50293279-50293301 TGGAGAAACTGAGGCACAGAGGG + Intergenic
1175253125 20:57621756-57621778 TGGGGAAACTGAGGCACAGAGGG - Intergenic
1175654481 20:60756962-60756984 TGGGGAAAAGGTTGCACAAAAGG + Intergenic
1175912852 20:62412995-62413017 TGGGGAAACTGAGGCACGGAGGG + Intronic
1175967373 20:62666270-62666292 TGGGGAAACTGAGGCATAGAGGG - Intronic
1175977321 20:62717493-62717515 TGGGGAAACAGAGGCACAGATGG - Intronic
1176076755 20:63252110-63252132 TGGAGACCCTGCAGCACAGAGGG + Intronic
1176295743 21:5071226-5071248 TGAGGATAAGGCAGCACATAAGG + Intergenic
1176366189 21:6034246-6034268 TGGGGAATGTGAAGCACAGCAGG + Intergenic
1177467352 21:21503775-21503797 TAGAGAAAATGCAGCTCAGAGGG + Intronic
1178193352 21:30313113-30313135 TGGGGAGAATGCAGAATAAAAGG - Intergenic
1178642172 21:34353754-34353776 TGGGGAAAATGAAGCCCCCACGG + Intergenic
1179096696 21:38322533-38322555 TGGAAGAAATGCACCACAGAGGG + Intergenic
1179462752 21:41548642-41548664 TGGGGAAACTGAGGCACAGGAGG + Intergenic
1179757328 21:43504299-43504321 TGGGGAATGTGAAGCACAGCAGG - Intergenic
1179861302 21:44190898-44190920 TGAGGATAAGGCAGCACATAAGG - Intergenic
1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG + Exonic
1181075737 22:20375548-20375570 TGGAGAAGATGCAGGACAGCCGG - Exonic
1181177021 22:21043738-21043760 AGAGGAAAATGCAGCTGAGAAGG + Intergenic
1181734219 22:24869136-24869158 TGAGGAAACTGAGGCACAGAGGG - Intronic
1182396842 22:30042225-30042247 TGTGGAAACTGAGGCACAGAGGG + Intergenic
1183317538 22:37145193-37145215 AGGGGAAACTGAGGCACAGAGGG + Intronic
1183376122 22:37466476-37466498 TTGGGAAACTGAGGCACAGAAGG - Intergenic
1183974828 22:41505618-41505640 TGAGGAAGCTGCAGCACAGAGGG - Intronic
1184122993 22:42465586-42465608 TGGGGAAACTGAGTCACAGAGGG + Intergenic
1184492578 22:44818584-44818606 TGGGGAAACTGAGGCAGAGAGGG - Intronic
1184566210 22:45293624-45293646 TGGGGAAACTGAAGAACAGAAGG - Intronic
1184779346 22:46638593-46638615 TGTGGAAACTGAGGCACAGAGGG + Intronic
1184852472 22:47128322-47128344 TGGGGAAAATGTGGAGCAGATGG - Intronic
1184879536 22:47296223-47296245 TGGGGAAACTGAGGCCCAGAGGG - Intergenic
950079857 3:10213706-10213728 TGGGTAAATTGAGGCACAGAGGG + Intronic
950133381 3:10563239-10563261 TGAGGAAACTGAAGCCCAGAGGG + Intronic
950573954 3:13819622-13819644 TGGGGAAACTGCTGCACAGAGGG - Intronic
950770758 3:15309055-15309077 TGGGAAAAGTACAGGACAGAGGG + Intronic
951355599 3:21663194-21663216 TGAGGAAATAGCAGCAAAGAAGG + Intronic
951673507 3:25210979-25211001 TGAGGAAACTGAGGCACAGAAGG - Intronic
952131662 3:30371059-30371081 TTGGGAGAATGCAGGAAAGAGGG - Intergenic
952469400 3:33630282-33630304 TGAGGAAACTGAAGTACAGAGGG + Intronic
953404069 3:42651841-42651863 TGGGGACACTCCAGCACTGAGGG + Intergenic
953434153 3:42865408-42865430 TGGGGGAAAAGCAGCAGTGAAGG - Exonic
953643870 3:44735430-44735452 TGGGGAAACTGAGGCTCAGAAGG - Exonic
953910707 3:46891533-46891555 TGGAGAAAATACAGCACAATGGG + Intronic
954553514 3:51501269-51501291 TGGGAAAAATGAGGCCCAGAGGG + Intergenic
954575524 3:51673981-51674003 TGGGGAAACTGAGTCACAGAGGG - Intronic
954708670 3:52494343-52494365 TGGGGAAACTGAGGCTCAGAGGG - Intergenic
955307902 3:57852460-57852482 TGAGGAAAATGAGGCACAAAAGG - Intronic
955407518 3:58634800-58634822 TGGGGAAGCTGAGGCACAGAGGG + Intronic
955994754 3:64668526-64668548 TGAGGAAACTGAGGCACAGAGGG - Intronic
956004830 3:64767547-64767569 TGGGGAAAATGAGACCCAGAGGG - Intergenic
956107791 3:65839005-65839027 TGGGCAAAAGACAACACAGATGG - Intronic
956666326 3:71645392-71645414 TGCGGAGAATGAACCACAGAAGG + Intergenic
958667060 3:97154604-97154626 AGGGGAAAATGCTGGACAAAGGG - Intronic
958738646 3:98040976-98040998 TGGGAGAAATGGAGAACAGAAGG + Intergenic
959709140 3:109367474-109367496 TGAGTAAACTGAAGCACAGACGG - Intergenic
960829640 3:121833058-121833080 TGGAGAAAATTCACCTCAGAAGG + Intronic
961055034 3:123780540-123780562 TGAGGAAACTACAGCCCAGAGGG + Intronic
961318585 3:126057072-126057094 TGGGGAGAGATCAGCACAGAGGG + Intronic
961556245 3:127698262-127698284 TGGGGAGACTGAGGCACAGAGGG + Intronic
961822991 3:129584726-129584748 TGGGGAAACTGAGGCTCAGAGGG - Intronic
961824289 3:129590761-129590783 TGGGGAAACTGAGGCTCAGAGGG + Intronic
962156979 3:132957749-132957771 TGAGGAAAAACCAGCACAAAAGG + Intergenic
962402649 3:135074708-135074730 TGGGGAAACTGAGGCCCAGAGGG - Intronic
963141250 3:141947973-141947995 TGGGGAAACTTGATCACAGATGG - Intergenic
964002626 3:151794812-151794834 TGGTGAAAATACATCACAGTTGG + Intergenic
964529697 3:157654125-157654147 TGAAGAAACTGAAGCACAGAAGG - Intronic
964644655 3:158946244-158946266 TGGAGTAAATCCAGCATAGAGGG - Intergenic
965663514 3:171067059-171067081 TGAGGAAACTGCATCTCAGAAGG + Intronic
965720046 3:171651470-171651492 TGAGGAAACTGAAGCCCAGAAGG - Intronic
966210445 3:177447940-177447962 TGTGGAAACTGTAGCACAGATGG - Intergenic
967156369 3:186696217-186696239 TGCAGGAAATGCTGCACAGAGGG - Intergenic
967198302 3:187048797-187048819 TGGAGAACATCCAGCACAGAAGG - Intronic
967433107 3:189411523-189411545 TTGGGAAAATGAAGAACAAAGGG - Intergenic
967788938 3:193526782-193526804 TGGGGAGAGAGCAGCAGAGATGG + Intronic
967887584 3:194343696-194343718 TAAGGAAACTGAAGCACAGATGG - Intronic
968193336 3:196686915-196686937 TGGGGAAAAGGCAGGAAGGAGGG - Intronic
968391830 4:199159-199181 GGAGGAAAATGAAGCACAGTAGG - Intergenic
968523353 4:1044424-1044446 TGGGGAAAACGCAGCTCTGAGGG + Intergenic
969099059 4:4755292-4755314 TGGGGAAACTGAGGCCCAGAGGG + Intergenic
969326267 4:6446069-6446091 TGAGGAAACTGAGGCACAGAGGG - Intronic
969342525 4:6551132-6551154 TGTGGATACTGCAGCACAAAAGG - Intronic
969602095 4:8182619-8182641 TGGGGAAACTGAGGCACGGAGGG - Intronic
969818765 4:9705202-9705224 TGAAGAGCATGCAGCACAGAAGG - Intergenic
970027410 4:11638214-11638236 TGGGGGAAATGCAGCAGCTAGGG - Intergenic
970458119 4:16245770-16245792 TGAGGAAACTGAGGCACAGAAGG - Intergenic
970558511 4:17259680-17259702 TGGGGAAACTGCAACACCCATGG - Intergenic
970970824 4:21981460-21981482 TGGGGAAATTTAAACACAGAAGG - Intergenic
971269142 4:25122397-25122419 TAAGAAAAATGCAGCCCAGAAGG + Exonic
972643039 4:40942837-40942859 TGGGAAGAATGCAGCACAGGTGG - Intronic
972842488 4:42947990-42948012 TGGGGAAATTGCAGAAGAGATGG + Intronic
973594373 4:52471205-52471227 TGGGGAAACTGCAGTTCAGAGGG - Intergenic
973961902 4:56118824-56118846 TGGAGAAATTACTGCACAGAAGG - Intergenic
974418357 4:61640468-61640490 GTGGGAAAATGGAGCAAAGAGGG - Intronic
975463257 4:74679502-74679524 TGGGAAAAATTCAGCAGTGAAGG + Intergenic
977300966 4:95267209-95267231 TGTGAAGAATGCAGCACTGAGGG - Intronic
977424851 4:96854308-96854330 TGAGGAGAATTCAGCACATAAGG + Intergenic
979090892 4:116480689-116480711 TGGGGAAAATGGAACACTGGGGG + Intergenic
979442778 4:120771516-120771538 TGGGGAAAATGCATTTTAGATGG - Intronic
979581485 4:122365837-122365859 TGGGGAGAAACCAGCACAGAAGG + Intergenic
979655079 4:123182856-123182878 TGGGGAGAAGGAAGCAAAGAAGG + Intronic
980883461 4:138738295-138738317 GGGGGAAAAAGTAACACAGAAGG - Intergenic
981411376 4:144435970-144435992 GAGGGAAAATCCAGCACAAAAGG + Intergenic
981545869 4:145892614-145892636 TTTGGAAAATGGAGCCCAGATGG - Intronic
982122480 4:152156387-152156409 TGGTTAAAAGACAGCACAGAGGG - Intergenic
982464487 4:155713367-155713389 AGGGAAATATGGAGCACAGAAGG - Exonic
983066654 4:163218061-163218083 TGTGGAAAATGTGGCAGAGATGG - Intergenic
983943203 4:173558094-173558116 TGGGGAAATGGCAGCCAAGAAGG + Intergenic
984779454 4:183511384-183511406 TAGGGAAAAAGCAGCTCAAATGG - Intergenic
985621701 5:959484-959506 TGGGGAAACTGAGGCACAGGGGG - Intergenic
986516016 5:8564690-8564712 TGAGGAAAATGGAGGAAAGAGGG - Intergenic
987130482 5:14855444-14855466 TGGGGAGTATGGAACACAGAGGG - Intronic
988285902 5:29215367-29215389 TGAGGTAAATGCATCTCAGAAGG - Intergenic
988419307 5:30986628-30986650 TGAGGAAAATGAAGTACAGTGGG + Intergenic
989206149 5:38810544-38810566 TGCTGAAAATGCAGCACACCCGG + Intergenic
989413070 5:41142188-41142210 TGGAGAAAATACAACACGGAAGG - Intergenic
990531177 5:56674975-56674997 TGAGGAGAAAGCAGCAAAGAAGG + Intergenic
990752157 5:59028549-59028571 TGAGAAAACTGAAGCACAGAAGG + Intronic
991162057 5:63514782-63514804 TGGAGAATAGACAGCACAGAAGG + Intergenic
991246367 5:64512491-64512513 TGAGGAAACTGAAGCAGAGAGGG - Intronic
991503860 5:67304221-67304243 TGGGTAAAATGGAGCCCACATGG - Intergenic
992736612 5:79728106-79728128 TGAGGAAAGTGAAGCACAGTAGG + Intronic
992953253 5:81881573-81881595 TGGAGAAAATGAAGCAGGGAGGG + Intergenic
993546088 5:89215309-89215331 TGGGTCAAATGTAGCAAAGATGG + Intergenic
993655467 5:90572992-90573014 TGGGGCAAATGCATCACAGATGG + Intronic
993816993 5:92561001-92561023 TGAGGCTAATGCAGCTCAGAGGG + Intergenic
995980800 5:118100833-118100855 TGGGGAAAATGCATCATAATAGG - Intergenic
996307589 5:122067381-122067403 TGAGGAAAATGAAGGAGAGAGGG + Intronic
996427753 5:123333931-123333953 TGGGGAAAATGGAACAAAGGTGG - Intergenic
996800662 5:127399037-127399059 TAAGGGAAATGCAGGACAGATGG - Intronic
997081487 5:130745079-130745101 TTGGGAAACAGCAGCATAGAAGG + Intergenic
997738084 5:136229097-136229119 TGGGGAAACTGAGGCCCAGAAGG + Intronic
998701963 5:144713257-144713279 TGGGGAAAAAACAGAACAGAAGG + Intergenic
999154849 5:149450771-149450793 TGGGGAAACTGAGGCCCAGAAGG + Intergenic
999711112 5:154319489-154319511 TGAGGAAAATGGAGCTCAGAGGG - Intronic
999837393 5:155389189-155389211 TCGGGAAAATGAAGTGCAGAAGG - Intergenic
1000212018 5:159116141-159116163 TGAGGAAACTGAGGCACAGAGGG + Intergenic
1001124309 5:169005820-169005842 TGGGGGAAACGCAGCGCAAAAGG + Intronic
1001127392 5:169032072-169032094 TGGGGAAAATGAGGGCCAGAGGG - Intronic
1002407453 5:179046958-179046980 TGGGGAAAAAGCAGCCCCAAAGG - Intergenic
1002458108 5:179357441-179357463 TGGGGAAGATGCTGAGCAGAGGG + Intergenic
1003134035 6:3419269-3419291 TGGGGGCAATGGAGCACGGATGG - Intronic
1003516307 6:6821727-6821749 TGAGGAAAGTGAGGCACAGAGGG - Intergenic
1003556395 6:7143084-7143106 TGGGGAAAATACAGCTAAAAGGG + Intronic
1003761798 6:9186817-9186839 TGGAGAAAAAGTAGCATAGAGGG + Intergenic
1005133442 6:22538616-22538638 AGGGGAAAAGGTAGCATAGAGGG - Intergenic
1007475531 6:42117319-42117341 TGAGAAAACTGAAGCACAGAGGG + Intronic
1007748077 6:44055386-44055408 TAGGGAAACTGAGGCACAGAGGG - Intergenic
1009198004 6:60710464-60710486 TGGGGAGATTGCCCCACAGAAGG - Intergenic
1011221973 6:85064260-85064282 TGGGGAAAATTTAGCAGAGCAGG - Intergenic
1011806581 6:91079436-91079458 AGGGGACCATGCAGCTCAGAAGG + Intergenic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1012603159 6:101123013-101123035 TGAGGAAACTGAGGCACAGAGGG + Intergenic
1012849594 6:104430815-104430837 GGGGGAAAATGGACCACAAAAGG + Intergenic
1013095365 6:106939909-106939931 TGGGTAAATTGCAGGGCAGAGGG + Intergenic
1014175686 6:118328430-118328452 TGTGGAAAATGCAGCCCATTAGG + Intergenic
1014222082 6:118807677-118807699 TGGGGAGAAGGCAGGACACATGG + Intergenic
1015048791 6:128813715-128813737 TGGGGAAAAGGCAGCGGGGAAGG - Intergenic
1015308380 6:131736074-131736096 TGAGACAAATGAAGCACAGAGGG + Intronic
1016092124 6:139992823-139992845 TGGGCTAAATGAAGCACAGAGGG + Intergenic
1016162300 6:140897246-140897268 CTGGGAAAATGCAGGTCAGATGG - Intergenic
1016475942 6:144428044-144428066 TGGGGGAAGTGCATCCCAGAAGG + Intronic
1017719190 6:157233166-157233188 TGGGGAAACTGAGGCTCAGAGGG + Intergenic
1017996451 6:159535426-159535448 AGGGGCAAATGCAGGAGAGAAGG + Intergenic
1018309926 6:162497535-162497557 TAATGAAAATGCAGCACAAAGGG - Intronic
1018846575 6:167561034-167561056 TGAGGAAACTGAGGCACAGAGGG - Intergenic
1019034544 6:169043346-169043368 TGGGGAAGAGGCAGCACTGAGGG - Intergenic
1019334238 7:475510-475532 TGGGGAGAGTGCAACACAGCTGG + Intergenic
1019550090 7:1597847-1597869 TTGGGAAAATGGAGCAGTGATGG + Intergenic
1019577261 7:1743544-1743566 TGGGGAAACTGAGGCCCAGAGGG + Intronic
1020101545 7:5396966-5396988 TGGGGAAACTGAGGCAAAGAAGG + Intronic
1020484418 7:8703864-8703886 TGGGGAACTTGCAGTACAAAGGG + Intronic
1021131663 7:16919811-16919833 TGAGGAAAATGCAGCAAAACTGG - Intergenic
1022468479 7:30666882-30666904 TGGGGAAACTGAGGCCCAGAGGG + Intronic
1022943509 7:35260777-35260799 TGCAGAAAATGAAGCTCAGAAGG + Intergenic
1023300487 7:38765621-38765643 TGGGAAAAATGCAGCACTCTGGG - Exonic
1024175730 7:46838746-46838768 TCTGGAAAATGCATCTCAGAAGG - Intergenic
1024500754 7:50102885-50102907 TTAGGAAAATGAAGCTCAGATGG + Intronic
1024658368 7:51471439-51471461 TGGGGCAGAAGCAGCACTGACGG - Intergenic
1025995987 7:66527982-66528004 TGGGGAAACTGAGGCACTGAGGG - Intergenic
1026588618 7:71678024-71678046 TGAGGAAACTGAGGCACAGAGGG + Intronic
1026987633 7:74564815-74564837 TGGGGAAACTGAGGCACTGAAGG - Intronic
1027745434 7:82068154-82068176 TGGGGAAACTGCAACACTGTAGG - Intronic
1027809669 7:82879352-82879374 TGGGGGAAGTGCGGAACAGACGG - Exonic
1027875904 7:83767732-83767754 TGGAAAAACTGAAGCACAGAAGG + Intergenic
1027884614 7:83888395-83888417 TGGAGAAATTGCAGTAGAGAAGG + Intergenic
1028146655 7:87327337-87327359 TGGGGAAATTGCAGTGGAGAGGG - Intergenic
1028530830 7:91836956-91836978 TGAGGAAACTGCAACACAGAGGG + Intronic
1028546826 7:92011022-92011044 TGGAGAAAATCCAGAATAGAAGG + Intronic
1028913429 7:96232812-96232834 TGAGGAAAATAAAGCTCAGAGGG + Intronic
1030902494 7:115141545-115141567 TGGGGAAAAGGGATCACAGCTGG + Intergenic
1031921685 7:127606769-127606791 TGGGGAATAGGCAGCACTGTTGG - Intergenic
1032195564 7:129786392-129786414 TGGAGAAAAGGCAGGGCAGAGGG + Intergenic
1032861796 7:135886887-135886909 TGGGGAAGTTGCAGAACAAAGGG + Intergenic
1032980351 7:137274605-137274627 TAGGAAAAATGCCTCACAGATGG + Intronic
1033509008 7:142035958-142035980 TGAGGAAATTGAGGCACAGAAGG + Intronic
1034871836 7:154692018-154692040 TGGGGAAACTGAGGCTCAGAGGG - Intronic
1035524268 8:300002-300024 TGGAGAAAATGCAGAACAAGTGG - Intergenic
1036136322 8:6164926-6164948 TGAGAAAATTGTAGCACAGAGGG - Intergenic
1036750985 8:11443671-11443693 TGGGGAGGTTCCAGCACAGAGGG + Intronic
1036870733 8:12433313-12433335 TGGAAAAGATGCAGCACAGCAGG - Intronic
1037572494 8:20170342-20170364 TGTGTAAGATGCAGCATAGATGG + Intronic
1037611898 8:20483040-20483062 TGGAGAAAAGGCATCAGAGAAGG + Intergenic
1037727211 8:21492594-21492616 TTGGGAAAATGCAAAGCAGAGGG + Intergenic
1038395922 8:27245344-27245366 TGGGGAAACTGAGGCTCAGAGGG + Intronic
1038416134 8:27397366-27397388 TGGGAAAGATGCAGCAGAAAGGG - Intronic
1039250179 8:35654949-35654971 TGGTAAAAATGATGCACAGATGG + Intronic
1039283094 8:36007450-36007472 TGGGGAGAAACCAGCACAAACGG + Intergenic
1039305048 8:36252205-36252227 TGGTGAACATGCTGCTCAGAGGG - Intergenic
1040560820 8:48521990-48522012 TGGGCAAATCCCAGCACAGAGGG + Intergenic
1041422378 8:57682303-57682325 TGGAGAAAATGTTGCACAGGTGG - Intergenic
1041672098 8:60502059-60502081 GGGGGAAAAGGGAGCAGAGAAGG - Intergenic
1041836290 8:62219652-62219674 TGGGAAATATGCAGCATAGATGG - Intergenic
1043546044 8:81316899-81316921 TGGGGAAAGGGAAGCACAGTTGG - Intergenic
1043651447 8:82598295-82598317 TGGAGAAAAAACAGCACAGATGG - Intergenic
1044781348 8:95746571-95746593 TGGGGAAATGACAGCACTGATGG + Intergenic
1045243733 8:100424871-100424893 TGGGGAAAATGCAGAACAACAGG - Intergenic
1046063729 8:109172353-109172375 TGGGGAAACTGAGGCAGAGACGG - Intergenic
1046586818 8:116157841-116157863 TGAGGAAATTGCAGCACAGAAGG + Intergenic
1046896975 8:119483650-119483672 TGAGGAAATTGAAGCCCAGAGGG - Intergenic
1047133796 8:122052394-122052416 TGAGGAAAAACCAGCACAAAAGG + Intergenic
1047523303 8:125612281-125612303 AGGGGAAAAAGCATCCCAGATGG + Intergenic
1047795947 8:128256085-128256107 TGGTGAAAAGGCATCTCAGATGG - Intergenic
1047975118 8:130122093-130122115 TGGGGAAAGTGCAGAATTGAGGG - Intronic
1048027787 8:130602428-130602450 TGAGGAAACTGAGGCACAGAAGG - Intergenic
1048048067 8:130791863-130791885 TGGGAAAAATCTAGCAGAGAGGG - Intronic
1048365823 8:133737777-133737799 GGTGGAAAATGCAGGTCAGATGG - Intergenic
1048536889 8:135304802-135304824 TGAGGAAGAGGCAGCACAGAAGG + Intergenic
1048759012 8:137770945-137770967 AGGGGTAAAGGCAGCCCAGAAGG + Intergenic
1048850632 8:138642034-138642056 TTGAGAAAATGCATCACAGAAGG - Intronic
1049428856 8:142549970-142549992 TGGGGAAACTGAGGCCCAGACGG - Intergenic
1049885602 9:24244-24266 TGAGGAAACTGAGGCACAGAAGG - Intergenic
1050080433 9:1910253-1910275 TGGAGAATATCCACCACAGAAGG - Intergenic
1050180089 9:2912840-2912862 TAGGGAAAATGAAGGAAAGAAGG + Intergenic
1050542511 9:6682208-6682230 TGGGGCAGATACAGCACAGGCGG - Intergenic
1051337569 9:16079918-16079940 TGAGGAAACTGAGGCACAGAGGG + Intergenic
1051730641 9:20139324-20139346 TGCGGAAACTGAGGCACAGAGGG - Intergenic
1053164550 9:35835262-35835284 TGGGGGGAATTCAGCAGAGATGG - Intronic
1053439774 9:38106769-38106791 TGAGGAAACTGAAACACAGAGGG + Intergenic
1055416336 9:76087938-76087960 TGAGAAAAATGGAGCAAAGAAGG - Intronic
1055666082 9:78554513-78554535 TGAGGACATTGAAGCACAGAGGG + Intergenic
1055894942 9:81163461-81163483 TGGGGAGAAACCAGCACAAAAGG + Intergenic
1056572818 9:87830637-87830659 TGGGGAAGATAAGGCACAGAGGG - Intergenic
1057185128 9:93053174-93053196 TGGGGAAACTGGAGCCCAGGGGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057821408 9:98333893-98333915 TGAGGAAACTGAGGCACAGAGGG - Intronic
1058188272 9:101881780-101881802 TGGAGAGAATGCAGTAAAGAAGG - Intergenic
1058574111 9:106381703-106381725 TGGGCAACAGGCAGCAAAGAGGG - Intergenic
1058734245 9:107879430-107879452 TGGGGAAACTGAGGCCCAGAGGG + Intergenic
1058783218 9:108360428-108360450 TGAGGAAACTGAAGCCCAGAAGG + Intergenic
1059563143 9:115354773-115354795 TGGTCATAAAGCAGCACAGACGG + Intronic
1059747207 9:117214585-117214607 TGGGGACCCAGCAGCACAGATGG + Exonic
1059937174 9:119322810-119322832 TGAGGAAACTGAGGCACAGAGGG - Intronic
1059982269 9:119785955-119785977 TGAGGAAATTGAAGCTCAGAAGG + Intergenic
1060496648 9:124124346-124124368 TGGGGAAACTGAGGCTCAGAGGG - Intergenic
1060550000 9:124480583-124480605 TGAGGAAACTGAGGCACAGAGGG - Intergenic
1060878559 9:127101336-127101358 TGTGATAACTGCAGCACAGAAGG - Intronic
1061265299 9:129501325-129501347 TGAGGAAACTGAGGCACAGAGGG + Intergenic
1061359140 9:130130064-130130086 TGGGGTAATGGCTGCACAGAGGG - Intronic
1061766197 9:132882928-132882950 TGGGGAAAGTGAGGCTCAGAGGG - Intronic
1062174493 9:135153425-135153447 TGTGGCAAATGCAGTGCAGAGGG - Intergenic
1185655532 X:1681332-1681354 AGGGAAAATAGCAGCACAGATGG + Intergenic
1185777865 X:2820140-2820162 GGGGGAAGATGCAGCTTAGATGG - Intergenic
1186410217 X:9340281-9340303 TGGTGAAACTGCAATACAGAAGG + Intergenic
1187203166 X:17155487-17155509 TGTGGAATATGGAGCAGAGAAGG + Intergenic
1187217369 X:17290082-17290104 TGGGGAGAATGAGACACAGAGGG + Intergenic
1188694325 X:33171157-33171179 TGGGGAAAAAACAGACCAGATGG + Intronic
1188966758 X:36563115-36563137 TGGGGAAAATTCATCACTGTTGG + Intergenic
1189047808 X:37611784-37611806 TAAGGAAAATGAGGCACAGAAGG - Intronic
1189350373 X:40271316-40271338 TGAAGAAAATGCAGTTCAGAGGG + Intergenic
1189812370 X:44792582-44792604 TGGGGAAAGTTGAACACAGATGG + Intergenic
1189868663 X:45359621-45359643 TGGGGACAAAGAAGCCCAGAGGG - Intergenic
1190092779 X:47454137-47454159 TGGGGAAAATGAGGAAGAGAAGG + Intronic
1190331869 X:49241055-49241077 TGAAGAAAGTGAAGCACAGAGGG + Intronic
1190753074 X:53379193-53379215 TGAGGAAACTGAGGCACAGAAGG + Exonic
1190759675 X:53428916-53428938 TGAAGAAACTGAAGCACAGAAGG - Intronic
1191149185 X:57202715-57202737 TGGGGAACATGCTTCACTGAAGG - Intergenic
1191653022 X:63562202-63562224 TGGGGAAACTGAGGCACAGAAGG - Intergenic
1191683859 X:63869096-63869118 TGAGGAAACTGAAGCTCAGAGGG - Intergenic
1192151702 X:68716774-68716796 TGGGGAAACTGAGGCCCAGAAGG - Intronic
1192410253 X:70927601-70927623 TGGGGAACATGGAGCCCAGGAGG + Exonic
1194912204 X:99659781-99659803 TAGCCAAAAAGCAGCACAGATGG - Intergenic
1195429490 X:104772599-104772621 TGTGGAAATTGTAGCAAAGATGG - Intronic
1195720692 X:107865040-107865062 TGGGGTAACTGAAGCACACAGGG + Intronic
1196028914 X:111074429-111074451 TGGGGAACATGCATGACACATGG - Intronic
1196061750 X:111415422-111415444 TGGGTGAAGTGAAGCACAGAGGG - Intergenic
1196764617 X:119231691-119231713 GGGGGAAAATGAAGCAGGGAAGG + Intergenic
1197133843 X:123037863-123037885 TGGGGAAAAGGCAGCATAAAAGG - Intergenic
1197721769 X:129750209-129750231 TGTGCAAAATGGAACACAGAGGG + Intronic
1198120102 X:133583942-133583964 TGGGGAAGATTCTGCACACAGGG - Intronic
1198596711 X:138243820-138243842 TGGAGCAAAGGCAGGACAGAAGG + Intergenic
1198949492 X:142054556-142054578 TGGGGAAATAGCAGAACAGTGGG + Intergenic
1199103954 X:143839601-143839623 TGGGGAAAGTGAAGCATATAGGG + Intergenic
1200213660 X:154357950-154357972 TGGGGAAACTGAGGCACAGAAGG + Intronic
1200504998 Y:4000939-4000961 TGGGGAAAATGGAGCCAAGCTGG + Intergenic
1201705248 Y:16929516-16929538 TGGGGAGAATGGAACACAGTTGG + Intergenic
1201767841 Y:17589231-17589253 TGGGGAAGATGCATCGCAAAGGG + Intergenic
1201833712 Y:18316754-18316776 TGGGGAAGATGCATCGCAAAGGG - Intergenic