ID: 1122149722

View in Genome Browser
Species Human (GRCh38)
Location 14:99718370-99718392
Sequence AGTCGGGAGCAGGCTCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122149722_1122149729 -4 Left 1122149722 14:99718370-99718392 CCCCTCCGAGCCTGCTCCCGACT 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1122149729 14:99718389-99718411 GACTCATGAGTGTGTTTCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 125
1122149722_1122149730 -3 Left 1122149722 14:99718370-99718392 CCCCTCCGAGCCTGCTCCCGACT 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1122149730 14:99718390-99718412 ACTCATGAGTGTGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122149722 Original CRISPR AGTCGGGAGCAGGCTCGGAG GGG (reversed) Intronic
900476134 1:2877220-2877242 AGTCGGGAGCCTCCTTGGAGTGG + Intergenic
900997396 1:6129973-6129995 AGGAGGAAGCAGGCTTGGAGAGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
905180733 1:36164614-36164636 AGCGGGGAGCAGGGTAGGAGAGG + Intronic
905429188 1:37909332-37909354 AGTTGGGAGCTGGCTCGGCCTGG - Intronic
905462442 1:38130487-38130509 AGGAGGAAGCAGGCTCAGAGAGG + Intergenic
906274781 1:44507612-44507634 AGTAGCGGGCAGGCTTGGAGTGG + Intronic
906320350 1:44811948-44811970 AGCAGTGAGCAGGCTTGGAGCGG - Intronic
908389278 1:63670335-63670357 GGTCGGAAACAGGCTGGGAGGGG + Intergenic
911546572 1:99224737-99224759 AGTGGGGAGCAGGCTCTGTGTGG + Intergenic
912428767 1:109617366-109617388 TGTGGGGAACAGGCTAGGAGGGG + Exonic
913586698 1:120281463-120281485 AGGCTGGAACAGGCTCAGAGAGG - Intergenic
913621488 1:120616907-120616929 AGGCTGGAACAGGCTCAGAGAGG + Intergenic
914568713 1:148893345-148893367 AGGCTGGAACAGGCTCAGAGAGG - Intronic
914604115 1:149236911-149236933 AGGCTGGAACAGGCTCAGAGAGG + Intergenic
915308881 1:154997338-154997360 AGTAGGGTGCAGGCTCTGAGGGG - Intergenic
916684110 1:167128769-167128791 AGTAGGGAGGAGGCAAGGAGGGG + Exonic
916769440 1:167893955-167893977 AGGAGGGTGCAGGCTCAGAGAGG + Intronic
919729351 1:200902876-200902898 AGTCGGGAGCAGGCCAGGACTGG + Intronic
920440301 1:205976175-205976197 ACTTGGGAGCAGGGTGGGAGTGG + Intergenic
920602829 1:207346526-207346548 AGTTGGGAGCAGCCACAGAGAGG + Intronic
922155538 1:223037699-223037721 AGTCGGGAGGAGGCATGGAGTGG + Intergenic
924437736 1:244058234-244058256 AGTCAGGTGCAGGCATGGAGAGG + Intergenic
1062895033 10:1096848-1096870 ACTCGGGTGAAGGCTCAGAGAGG + Intronic
1064337686 10:14458452-14458474 AGTCAGGGGCATGCTTGGAGAGG - Intronic
1065844849 10:29735984-29736006 AGGCGGGAGCACCCTCGGACTGG + Intronic
1068118661 10:52762103-52762125 AGCGGGGAGCTGGCTGGGAGAGG - Intergenic
1070963680 10:80516548-80516570 GGGCGGGGGCAGGCTGGGAGGGG + Intronic
1074724109 10:116289836-116289858 AGTCGGGAGGAGGAAGGGAGAGG - Intergenic
1075046910 10:119153637-119153659 AGTGCAGAGCAGGCTGGGAGGGG + Intronic
1075081269 10:119385466-119385488 TGTTGGGAGCAGGCTTTGAGGGG + Intronic
1076848703 10:133082508-133082530 AGGCAGGAGTAGGCTCTGAGTGG - Intronic
1077315383 11:1917373-1917395 AGTGGGGAGCAGGCTGTGGGAGG - Intergenic
1077457563 11:2690048-2690070 AGACAGAAGCAGGCTAGGAGAGG - Intronic
1079942667 11:26701068-26701090 AGTCAGCAGCTGGCTCTGAGTGG + Intronic
1081029662 11:38063052-38063074 AGTGGGGAGCAGTCTGGGTGAGG - Intergenic
1081135380 11:39433888-39433910 AGTAGGGAGAAGGCTTGAAGAGG - Intergenic
1082781896 11:57294489-57294511 TCTCGGGAGCAGCCTCAGAGGGG - Intergenic
1083421025 11:62553364-62553386 AGTGGGGAGCAGGGAGGGAGGGG + Intronic
1083656165 11:64230714-64230736 AGACTGAAGCAGGCCCGGAGAGG - Exonic
1084028314 11:66466641-66466663 AGTCCTGAGCCGGCTAGGAGGGG + Intronic
1084416527 11:69035834-69035856 AGAGGGGAGAAGGCTGGGAGGGG - Intergenic
1084959869 11:72710784-72710806 CAGCGGGAGCAGGCTTGGAGGGG - Intronic
1085389753 11:76176369-76176391 AGAGAGGAGCAGGCTAGGAGGGG + Intergenic
1085479002 11:76806337-76806359 GGAAGGGAGCAGGCTCAGAGAGG - Intergenic
1090976160 11:131682522-131682544 AGTCCTGAGCAGGCTGGCAGAGG - Intronic
1091588977 12:1831778-1831800 AGTGGGGAGCTGGCTGGGGGAGG - Intronic
1094178757 12:27568643-27568665 AGACGGGAGAAGTCTGGGAGAGG - Intronic
1101378006 12:104187688-104187710 TGGCGGGAGCAGGCTCTGTGCGG + Intergenic
1104621674 12:130318600-130318622 AGTTGGGAGGAGGCTGGGAATGG + Intergenic
1104901179 12:132190255-132190277 AGTCAGGGGCAGCCTCGGCGGGG - Intergenic
1107385321 13:39902102-39902124 AGTCCAGAGAGGGCTCGGAGAGG + Intergenic
1107440755 13:40425436-40425458 AGATGAGAGCAGGCTTGGAGTGG - Intergenic
1107834744 13:44404366-44404388 AGTAGGGAGCATGCAGGGAGAGG - Intergenic
1112914181 13:104525647-104525669 AGTTGGGGGCAGCCTCGGTGGGG - Intergenic
1114625589 14:24127537-24127559 AGTGGTGAGGAGGCTAGGAGAGG - Intronic
1115235726 14:31207410-31207432 TGTTGGGAGCTGGATCGGAGCGG - Exonic
1121218802 14:92269622-92269644 ACTCGGGGGAAGGCTGGGAGGGG - Intergenic
1121246121 14:92462048-92462070 AGGCGGAAACAGGCTCAGAGAGG + Intronic
1122149722 14:99718370-99718392 AGTCGGGAGCAGGCTCGGAGGGG - Intronic
1122328242 14:100895571-100895593 TGTGGGGAGCAGGGTCGGGGTGG + Intergenic
1122746084 14:103897940-103897962 AGCAGGGAGCAGGCACGGGGAGG + Intergenic
1124179834 15:27462177-27462199 AGTGAGGAGCCGGCTCAGAGGGG - Intronic
1125530140 15:40407746-40407768 AGTCGGGGGCAGTCAGGGAGTGG + Intronic
1128709095 15:69858488-69858510 CCTCTGGTGCAGGCTCGGAGGGG - Intergenic
1129240779 15:74250932-74250954 AGTCCTGAGCAGGCTCACAGTGG + Intronic
1129856225 15:78827194-78827216 AGGAGGAAGCAGGCTCAGAGAGG - Intronic
1129880723 15:79004503-79004525 AGGCGGGAGCAGGCCCTGTGTGG - Intronic
1130964403 15:88686267-88686289 AGGAGGGAGCAGGCTAGGGGAGG - Intergenic
1131032561 15:89198655-89198677 AGGAGGGAACAGGCTCAGAGAGG - Exonic
1131144001 15:90000298-90000320 AGTCGAGAAACGGCTCGGAGTGG + Intergenic
1132936215 16:2482636-2482658 AGTGGGCAGGAGGCTGGGAGTGG + Intronic
1133108643 16:3532127-3532149 AGTAGGGGGCAGGCCAGGAGTGG - Intronic
1141028609 16:80569693-80569715 AGTCGGGGGAAGGCTGGCAGAGG - Intergenic
1142036075 16:87862754-87862776 AGTCAGAAACAGGCTCGGCGGGG + Intronic
1143020989 17:3917133-3917155 ATGAGGAAGCAGGCTCGGAGAGG - Intergenic
1143810676 17:9468948-9468970 TCTGGGGAGCAGCCTCGGAGGGG - Intronic
1144628700 17:16858640-16858662 AGTGGGGAGGTGGCTCGGAGAGG - Intergenic
1147065759 17:37922022-37922044 AGCCTGGAGCAGGGTGGGAGGGG - Intergenic
1147176427 17:38658852-38658874 GGTCCGGAGGAGGCTGGGAGAGG + Intergenic
1151323192 17:73363847-73363869 AGTCAGGTGCAGGGCCGGAGTGG - Intronic
1151958001 17:77390019-77390041 TGACGGGAGCAGGCACAGAGAGG + Intronic
1152597271 17:81243865-81243887 GGCCGGGAGGAGGCTGGGAGGGG - Intergenic
1152708063 17:81855637-81855659 AGACGGGAGCAGGCGCGGCAGGG - Intronic
1152864360 17:82713366-82713388 AGTCCGGAGCAGTCTCTGCGTGG - Intergenic
1156384413 18:36592766-36592788 TGGAGGGAGCAGGCTGGGAGTGG + Intronic
1156502330 18:37567399-37567421 AGCCGGGAGCAGGGTCCGAGCGG + Intergenic
1157543625 18:48531675-48531697 AGTCTGGGTCAGGCTGGGAGTGG + Intergenic
1162016779 19:7850526-7850548 AGCCGGGAGCAGGCCCTGCGGGG - Intronic
1163783664 19:19263306-19263328 AGTCAGCAGCAGGCTCAGAGAGG - Intergenic
1164598046 19:29542990-29543012 AGTCGGAAGCAGGCTGGGATTGG - Intronic
1165391910 19:35543731-35543753 AGTAGGGGGCAGGCTGGGCGAGG - Exonic
925203966 2:1991140-1991162 ACTCGGAAGCAGGCTGGAAGGGG - Intronic
927518957 2:23687942-23687964 ACTCGGCCGCAGGCTGGGAGAGG - Intronic
929058566 2:37900519-37900541 TGGCGGGAGCAGGCTCTGTGTGG + Intergenic
929999735 2:46853077-46853099 AGCTGGGAGGAGGCACGGAGGGG - Intronic
930171506 2:48256127-48256149 TGTAGGGAGGAGGCTAGGAGAGG + Intergenic
930612239 2:53555523-53555545 AGTGGGGTCCAGGCTTGGAGAGG + Intronic
932219450 2:69988836-69988858 AGTCTGGAGTAGGATGGGAGGGG + Intergenic
934709122 2:96503675-96503697 GGTCTGGAGCAGGGTCGGGGTGG + Intronic
941709222 2:168694239-168694261 GGTCGGGGGGAGGCTCAGAGAGG - Intronic
942895434 2:181047751-181047773 GGTCTGGAGGAGGCCCGGAGGGG - Intronic
944024116 2:195143223-195143245 TGACGGGAGCAGGCTCTGTGTGG + Intergenic
944062316 2:195582798-195582820 AGTAGGGATCAGACTCGAAGGGG + Intronic
1172078059 20:32314903-32314925 AGGCAAGAGCAGGCTCTGAGTGG - Intronic
1173257411 20:41404718-41404740 AGCTGGGAGCAGGCTCTGGGTGG + Exonic
1175930480 20:62491612-62491634 AGTGGGGAGCAGGCACAGAGAGG - Intergenic
1177263613 21:18757533-18757555 AGTCGGGGGCATGCTGGGATAGG + Intergenic
1178947243 21:36958957-36958979 AGTCTGGAGCAGGGTAGGCGCGG + Intronic
1181337789 22:22153860-22153882 AGGCTGGAGCAGGCTGTGAGGGG + Intergenic
950097139 3:10336988-10337010 AGGTGGGGGCAGGCTGGGAGGGG + Intronic
950138983 3:10602113-10602135 AGTGGGGAGGGGGCTCCGAGGGG - Intronic
950452926 3:13075456-13075478 AGGCGGAAACAGGCTCAGAGTGG + Intergenic
952333103 3:32382704-32382726 AGTGGGGAACAGGCTGGGTGTGG - Intergenic
961536628 3:127574523-127574545 AGTGGGGAGCAGGTTTGGGGTGG - Intronic
976207988 4:82640167-82640189 AGGCAGGAGCAGGGTCTGAGTGG - Intronic
977932107 4:102760677-102760699 AGGCGGGCGCAGGCTCGCCGCGG + Intronic
978244301 4:106553644-106553666 AATAGGGAGCTGGCTAGGAGAGG - Intergenic
982242356 4:153313138-153313160 AGTGGGGAGCAGGAAAGGAGTGG - Intronic
983188444 4:164728076-164728098 AAGCAGGAGCAGGCTCAGAGGGG - Intergenic
997376792 5:133403272-133403294 GCTCTGAAGCAGGCTCGGAGAGG - Intronic
997452793 5:133996901-133996923 AGGTGGGAGCAGGCAGGGAGTGG - Intronic
998587016 5:143438013-143438035 AGTGAGGAGGAGGCTCAGAGAGG - Intergenic
999149966 5:149420360-149420382 GGTCGGAAACAGGCTCAGAGAGG + Intergenic
1001597275 5:172906356-172906378 ACCAGGGAACAGGCTCGGAGAGG - Intronic
1003418532 6:5935267-5935289 AGAAGGCAGCAGGCTCAGAGAGG - Intergenic
1003870363 6:10398200-10398222 AGGCGGGTGCAGAGTCGGAGAGG + Exonic
1006341413 6:33449124-33449146 AGTCAGGAGGAGGCTGGGAGGGG - Intronic
1007175957 6:39897632-39897654 ATTGGGAAGCAGGCTCTGAGTGG + Intronic
1007373680 6:41442693-41442715 AGTGGGAAACAGGCTCTGAGAGG - Intergenic
1007838808 6:44698649-44698671 AGTGGGGAGCATGCTGGGTGAGG + Intergenic
1010353514 6:74904175-74904197 AGGCGGCAGCAGGCTGGGGGAGG + Intergenic
1016084326 6:139894486-139894508 TGTCAGGAGCAGGCTCTGTGCGG + Intergenic
1018156991 6:160994289-160994311 ACTCGGGGGAAGGCTCAGAGCGG - Intronic
1019370392 7:660161-660183 AGCCGGGAGAAGGCTGGGATGGG - Intronic
1022124445 7:27341938-27341960 AGTGGGAAGCAGGCCTGGAGAGG - Intergenic
1023429875 7:40079603-40079625 AGGAGGAAGCAGGCTCAGAGAGG + Intronic
1026140248 7:67699467-67699489 AGTCGGTGGCAGGCTCAGGGAGG + Intergenic
1029550509 7:101234837-101234859 AGTGGGGAGCAGGGTGGGAGGGG - Intronic
1029930410 7:104365007-104365029 AGATGGGAGCAGGCTGGGTGTGG + Intronic
1030132795 7:106217324-106217346 AGCTGGGAGCAGGCTTGTAGAGG + Intergenic
1030986702 7:116250198-116250220 AGCCAGTAGCAGGCTCAGAGGGG + Exonic
1031982202 7:128135519-128135541 AGCCAGGAGCAGGCTGTGAGAGG + Intergenic
1032197846 7:129799587-129799609 GGTAGGGAGGAGGCTAGGAGGGG + Intergenic
1035363465 7:158329235-158329257 GGTGAGGAGCAGGCTAGGAGGGG + Intronic
1035725599 8:1823581-1823603 AGCCGGGAGCAGGCTCTGCGGGG + Intergenic
1035906810 8:3520840-3520862 AGTGGGGTTCAGGCTGGGAGAGG - Intronic
1037811504 8:22089489-22089511 GGTCGGGAGGAGTCTGGGAGCGG - Intronic
1038902273 8:31857201-31857223 AGGCGGCAGCAGGCTGGGGGAGG - Intronic
1048004082 8:130404565-130404587 ACTGAGGAGCAGGCTGGGAGAGG - Intronic
1053147816 9:35723857-35723879 AGTGGGGGGCAGGCTTGGAATGG + Intronic
1055574644 9:77648627-77648649 AGGCGGCAGCAGGCTGGAAGAGG + Intergenic
1057269914 9:93644925-93644947 AGTAGGGAGCAGGCCAGGACAGG + Intronic
1060055205 9:120407223-120407245 CGTCGGGAGAAGGCTGGAAGGGG - Exonic
1060736211 9:126067970-126067992 AGAGGGGAGCAGGGGCGGAGGGG + Intergenic
1060978718 9:127780256-127780278 AGTCGGGAGCAGGCCTGGCCAGG - Intergenic
1062444079 9:136586054-136586076 TGTGGGGAGCAGGCTCGGCAGGG + Intergenic
1062525548 9:136976763-136976785 AGTCTGGACCAGACTCGGGGTGG + Intergenic
1188007018 X:25022656-25022678 AGTCGGGAGCAGAGTGGGGGTGG - Intergenic
1195220567 X:102742318-102742340 AGTCGGGGGCGGGGTCGGGGGGG + Intronic
1200150467 X:153948977-153948999 GGTCGGGGGCAGGCATGGAGGGG - Exonic