ID: 1122150242

View in Genome Browser
Species Human (GRCh38)
Location 14:99721754-99721776
Sequence ACTGAGGTCCAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 12, 3: 86, 4: 536}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122150242_1122150249 17 Left 1122150242 14:99721754-99721776 CCCTTCTCCTTCTGGACCTCAGT 0: 1
1: 0
2: 12
3: 86
4: 536
Right 1122150249 14:99721794-99721816 GACGGTGAGGCTGATGTCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 140
1122150242_1122150250 18 Left 1122150242 14:99721754-99721776 CCCTTCTCCTTCTGGACCTCAGT 0: 1
1: 0
2: 12
3: 86
4: 536
Right 1122150250 14:99721795-99721817 ACGGTGAGGCTGATGTCCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 124
1122150242_1122150246 -1 Left 1122150242 14:99721754-99721776 CCCTTCTCCTTCTGGACCTCAGT 0: 1
1: 0
2: 12
3: 86
4: 536
Right 1122150246 14:99721776-99721798 TTTCTCCATCTGTCACGTGACGG 0: 1
1: 1
2: 8
3: 71
4: 605
1122150242_1122150248 4 Left 1122150242 14:99721754-99721776 CCCTTCTCCTTCTGGACCTCAGT 0: 1
1: 0
2: 12
3: 86
4: 536
Right 1122150248 14:99721781-99721803 CCATCTGTCACGTGACGGTGAGG 0: 1
1: 0
2: 1
3: 4
4: 63
1122150242_1122150253 25 Left 1122150242 14:99721754-99721776 CCCTTCTCCTTCTGGACCTCAGT 0: 1
1: 0
2: 12
3: 86
4: 536
Right 1122150253 14:99721802-99721824 GGCTGATGTCCCAGGGGCCTGGG 0: 1
1: 0
2: 3
3: 35
4: 275
1122150242_1122150252 24 Left 1122150242 14:99721754-99721776 CCCTTCTCCTTCTGGACCTCAGT 0: 1
1: 0
2: 12
3: 86
4: 536
Right 1122150252 14:99721801-99721823 AGGCTGATGTCCCAGGGGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 309
1122150242_1122150251 19 Left 1122150242 14:99721754-99721776 CCCTTCTCCTTCTGGACCTCAGT 0: 1
1: 0
2: 12
3: 86
4: 536
Right 1122150251 14:99721796-99721818 CGGTGAGGCTGATGTCCCAGGGG 0: 1
1: 0
2: 3
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122150242 Original CRISPR ACTGAGGTCCAGAAGGAGAA GGG (reversed) Intronic
901064835 1:6489734-6489756 ATTGAGGCCCAGTAGGGGAAGGG - Intronic
901460489 1:9388327-9388349 ACTGAGGCACAAAAGGGGAAAGG + Intergenic
901797021 1:11685545-11685567 ACTGAGGTTCAGAGAAAGAAGGG - Intronic
901910940 1:12457484-12457506 TGTGAGGTACACAAGGAGAAAGG - Intronic
902195399 1:14794432-14794454 ACTGAGGTTCAGGAAGATAAAGG - Intronic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902555183 1:17242699-17242721 ACTGAGGCTTAGAAGGAGAGTGG + Intronic
902699615 1:18162883-18162905 AGTGAGGTCCAGAAGGCAGAAGG + Intronic
902735071 1:18395162-18395184 ACTGAGGCCCAGAGGGAGAGAGG + Intergenic
902839222 1:19064916-19064938 ACTGAGGCCCAGGAGGGGCAGGG - Intergenic
903022050 1:20401472-20401494 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
903028590 1:20446873-20446895 ACTGAGGCCCATAGAGAGAAAGG + Intergenic
903195764 1:21686743-21686765 TCTGAGGTCCAGGTGGAGATGGG + Intronic
903240284 1:21978233-21978255 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903244033 1:22002867-22002889 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903321405 1:22545521-22545543 ACTGAGGCCCAGAAGAGAAAGGG - Intergenic
903453336 1:23470136-23470158 ACTGAGGCATAGAAGGAGGAAGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903671329 1:25037538-25037560 ACTGAGGTTCAGAAAGGGAAAGG + Intergenic
903677551 1:25073923-25073945 ACTGAGGCCCAGAGAGGGAACGG - Intergenic
904271457 1:29353069-29353091 ATTGAGGGCCAGAATGGGAAAGG + Intergenic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904516794 1:31062052-31062074 ACTAAGGTACAGGAGGAAAATGG + Intronic
904537161 1:31207481-31207503 ACTCATGTACTGAAGGAGAAAGG + Intronic
904586963 1:31586005-31586027 ACTGAGACTCAGAAAGAGAAAGG + Intronic
904615097 1:31745369-31745391 CCTCAGGGCCAGCAGGAGAAAGG - Intronic
905052137 1:35060845-35060867 AGAGAGGCCCAGAAGGAGACTGG + Intronic
905707567 1:40073057-40073079 GTTGATCTCCAGAAGGAGAAAGG + Exonic
905743813 1:40395783-40395805 ACTGAGGTCTACTAGGAGAAAGG - Intronic
906064154 1:42968182-42968204 ACTGAGGTCTAACAGGATAAAGG - Intergenic
906155537 1:43611974-43611996 GGTGAGGGCCAGAAGGAGACCGG + Intronic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
906711149 1:47930808-47930830 ACTGAGGCCCAGAAAGGAAAAGG + Intronic
906838926 1:49114755-49114777 CCTGAGGTGAGGAAGGAGAAGGG + Intronic
907114650 1:51958285-51958307 ACTGAGGCCCAGAGGGTAAAGGG - Intronic
907271209 1:53292337-53292359 ATTGAGGCCCAGAAAGGGAAAGG + Intronic
907272245 1:53297970-53297992 ACTGAGGCCCAGAATGGGAAGGG - Intronic
907411347 1:54285896-54285918 ACTGAGTCCCAGAACGAGAAAGG - Intronic
907939897 1:59077519-59077541 ACTGTGGGTCAGAAGGATAAAGG + Intergenic
908239529 1:62177064-62177086 CCTGAATTCCAAAAGGAGAATGG - Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908383655 1:63619985-63620007 ATTGAGGCTCAGAAGGACAAGGG + Intronic
910595058 1:88972189-88972211 ACTGAGGTCCTCAAGGAAGAGGG - Intronic
912409516 1:109470532-109470554 ATGGAGGTCCAAGAGGAGAAAGG + Intronic
914846744 1:151287669-151287691 ACTGGGGGACAGAAGGTGAATGG + Exonic
915205730 1:154269188-154269210 ACTGTGGCACAGGAGGAGAAGGG - Intronic
915702695 1:157811285-157811307 ACTGAAGTACAGCAGGGGAATGG + Intronic
916464790 1:165062918-165062940 AAAGAGGTTCAGGAGGAGAAAGG + Intergenic
916930644 1:169575172-169575194 ACTGAGGTCCAAAGGCAGAGAGG + Intronic
917436859 1:175030895-175030917 AGTGAGGTCCAGTGGGACAATGG - Intergenic
918028911 1:180783717-180783739 ACTGATGTCCAAAAGGGGAGTGG - Intronic
918467673 1:184837924-184837946 ACTGAGGGAAAGAAGGAAAAGGG - Intronic
918796778 1:188908993-188909015 ACTGAGGTTCAGAAAGAAAATGG + Intergenic
919762253 1:201105657-201105679 ACTGAGGCCCAGAGAGAGCAAGG - Intronic
919874213 1:201850343-201850365 ACAGAGGCCCATTAGGAGAATGG + Intronic
920749216 1:208658350-208658372 ACTGAGGACCAACAGGAGGAAGG + Intergenic
921104384 1:211961110-211961132 ACTGATGTCCTGAAAGAGATAGG + Intronic
921816843 1:219574039-219574061 ACTAAAGTCTGGAAGGAGAATGG + Intergenic
922026418 1:221753832-221753854 ACTGAGGCTCAGAAAGAGTAAGG - Intergenic
922101940 1:222484185-222484207 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
922263020 1:223959307-223959329 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
922898729 1:229120294-229120316 AGTGAAGTCTAGGAGGAGAAGGG + Intergenic
922903681 1:229157698-229157720 CCTGAGCTCCAGAAGCAGAGTGG + Intergenic
923054044 1:230412085-230412107 ACAGAGATAGAGAAGGAGAAGGG + Intronic
923809411 1:237296178-237296200 ATTGAAGTCCAGCAGGTGAAGGG + Intronic
924344858 1:243064308-243064330 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
1063040211 10:2330028-2330050 TTGAAGGTCCAGAAGGAGAAGGG + Intergenic
1063212386 10:3892863-3892885 ACTGAGGCACAGAAGGTGACAGG - Intergenic
1063652479 10:7951815-7951837 ACTGAAGTTCAGAAGGATGAAGG + Intronic
1064332276 10:14405090-14405112 AGTGAGGTCCAGGAAGAGCATGG + Intronic
1064503597 10:16004136-16004158 ACTGAGGTCCAAAAAGAAAAAGG + Intergenic
1064984216 10:21193599-21193621 ACTGAGCAACAGAAGGACAAAGG + Intergenic
1065306415 10:24373355-24373377 ACTTACCTCCAGAAGGGGAAAGG - Intronic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1067279519 10:44860805-44860827 ACTGAGATTCAGAAAGAGAAAGG - Intergenic
1067834036 10:49627117-49627139 ACTGTTCTCCAGAAGGGGAATGG - Intronic
1068015757 10:51514665-51514687 ACCGAAGTCAATAAGGAGAAGGG + Intronic
1068496365 10:57789408-57789430 AGAGAGGACCAGAAAGAGAAGGG - Intergenic
1068524327 10:58110022-58110044 ACTGATGTGCAGAAAAAGAATGG + Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068601171 10:58958147-58958169 AGTGAGGTCCAGATGTGGAAGGG + Intergenic
1069535402 10:69249163-69249185 ACCGAGGACCAGAAGGATCAAGG - Intronic
1069716950 10:70527193-70527215 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
1069875608 10:71561217-71561239 ACTGAGGGCCAGAGTGAAAACGG - Intronic
1070670141 10:78372065-78372087 ACTGAGGCCCAAGAAGAGAAAGG - Intergenic
1070704409 10:78627317-78627339 ACTGAGCTCCAGGAGGGGAGGGG - Intergenic
1070775463 10:79107347-79107369 ACTGAGGCACAGAGAGAGAAAGG - Intronic
1071296197 10:84221942-84221964 ACTGAGGGGGACAAGGAGAAAGG - Exonic
1071529505 10:86377954-86377976 TGTGTGGTCCAGACGGAGAATGG - Intergenic
1071692487 10:87836780-87836802 TCGGAGATCCAGAAGAAGAAAGG - Intronic
1072155798 10:92722754-92722776 ACTGAGGTCCAAAGAGGGAAAGG - Intergenic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1073145957 10:101282157-101282179 ACTGAGCTCCATGAGGAGCATGG + Intergenic
1073339803 10:102735973-102735995 CCTGCTGTCCAGAAGGAGACAGG + Intronic
1073909152 10:108320763-108320785 ACTGAGGTCCAGAAGGACACAGG - Intergenic
1074400712 10:113139284-113139306 GCTGAGGTGGAGAAGGAAAAGGG - Intronic
1074470176 10:113719797-113719819 ACTGAGGTCCATGGGGAGACGGG - Intronic
1075173818 10:120141011-120141033 CCTGGGGTCCAGAAAGAGAAGGG - Intergenic
1075982021 10:126748283-126748305 ACTGAGGCCCGGAAGGAAGAAGG + Intergenic
1077132584 11:980616-980638 ACTGAGGGCCAGGAGGAGCGGGG + Intronic
1077246693 11:1542684-1542706 ACTGAGGTCCAGTAGAGGGAGGG + Intergenic
1077473295 11:2774878-2774900 ATTGAGGCCCAGGATGAGAAAGG - Intronic
1077899677 11:6478550-6478572 ACAGAGGTCCAGAAGTTGGAGGG - Intronic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1079696034 11:23483853-23483875 ACGGAGGTCAAGCAGGAGACGGG + Intergenic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1081192271 11:40118716-40118738 CCTGAGGACGAGAATGAGAAAGG + Intronic
1081550547 11:44107804-44107826 AATGAGGCCCAGGAGGACAATGG - Exonic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082999870 11:59281430-59281452 ACTTAGTTCCAGAGGGAGGAAGG + Intergenic
1083173867 11:60937629-60937651 GCAGAGTTCCAGAAGCAGAAAGG + Intronic
1083537975 11:63489682-63489704 ACAGTGGTCAAGAAGGTGAAAGG + Intronic
1083892504 11:65603204-65603226 ACTGAGGTTCTGAAGGGTAAGGG + Intronic
1083944041 11:65914123-65914145 ACTGAGGCCCAGAGAGAGAGTGG + Intergenic
1084264810 11:67999406-67999428 ACTGAGGCCCAGAGGGCGGAAGG + Intronic
1084351350 11:68602200-68602222 ACTGAGGTCTAGAGGGAAGAAGG + Intronic
1084445991 11:69204121-69204143 ACTGAGGCCCAGAAGGAGCCAGG + Intergenic
1084569890 11:69953054-69953076 ACTGAGATCGAGAAAGAGACAGG + Intergenic
1084940856 11:72612524-72612546 ACTGAGGCTCAGAAGAGGAAAGG - Intronic
1084949951 11:72659345-72659367 ACTGAGGTCCTAAGGAAGAAAGG - Intronic
1085163672 11:74374744-74374766 ACTGAGTCCCCAAAGGAGAAAGG + Intronic
1085309434 11:75507403-75507425 ACTGAGGCCCAGAGGGAGAAAGG + Intronic
1085350034 11:75792398-75792420 ATTGAGGCCCAGAGGGAGAGAGG - Intronic
1085386510 11:76161133-76161155 ACTGAGGTCCAGAAAGGGGCAGG + Intergenic
1085521195 11:77139808-77139830 ACTGAGGGCCAAAGAGAGAAAGG - Intronic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1085738284 11:79058240-79058262 ACGGTGGTCAAGAAGGATAATGG + Intronic
1086046932 11:82543848-82543870 ACTGAGGTCCAGAAAGGTTAGGG + Intergenic
1086402063 11:86469185-86469207 ACTGAGACCCAGACAGAGAAAGG - Intronic
1088712672 11:112522818-112522840 TCTGAGTTCCAGAAGCAGAATGG + Intergenic
1089231871 11:116984373-116984395 ACAGTGGTCCATAAGGGGAAAGG + Intronic
1089280752 11:117372719-117372741 ACTGATGTCAAGAAGTACAAGGG - Intronic
1089632777 11:119793973-119793995 ACTGAGGTCAGAAAGGAGCAGGG - Intergenic
1089662577 11:119995024-119995046 ACTGAAGTCCAGAAAGGGAAAGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090455906 11:126849607-126849629 AATCAGCTGCAGAAGGAGAAAGG + Intronic
1091770136 12:3146084-3146106 ACTGAGGTCCAGGAGGGGAGTGG - Intronic
1091822041 12:3482789-3482811 ACTGAGGTCCACAATGAGCCTGG + Intronic
1091840193 12:3615134-3615156 TCTGGGGTCTAGAAAGAGAAAGG + Intronic
1091880817 12:3976601-3976623 ACTGAGGTCAGGGAGGTGAATGG - Intergenic
1092078664 12:5694560-5694582 ACTGAGGCCGAGAGGGGGAAGGG - Intronic
1092186120 12:6479731-6479753 ACAGTCGTCCAGAAGGAAAATGG + Intergenic
1092767198 12:11863382-11863404 ACAGAGGTCTACAAGGAAAAAGG + Intronic
1092976938 12:13754493-13754515 TCAGTGGTCCAGAAGGTGAATGG + Intronic
1093126575 12:15336858-15336880 AGTGAGGTCAAGTAGGAGAATGG - Intronic
1093936589 12:25008240-25008262 ACTGGTGTCCTGAAGGAGAGAGG + Intergenic
1095744953 12:45647679-45647701 ACTGAGCTGTAGAATGAGAATGG + Intergenic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1096838730 12:54368579-54368601 ACTGAGGTCCAGAGAGGGCAAGG + Intergenic
1096881851 12:54679570-54679592 ATTGAGGTCCAGATGTAGACAGG + Intergenic
1097860144 12:64510730-64510752 ACTATGGTCTTGAAGGAGAATGG + Intergenic
1098250298 12:68561994-68562016 ACTGAGGTTCAGAAAGATTAAGG + Intergenic
1098912656 12:76225567-76225589 ACCGAGGGCTAGGAGGAGAAGGG - Intergenic
1101684751 12:107007910-107007932 ACTGAACTCAAGAAGGAAAAGGG - Intronic
1102020595 12:109679668-109679690 ACTAAGGTCCAGAGGGGGAAAGG + Intergenic
1102143399 12:110635753-110635775 ACTGAGGTCCAGATAAATAATGG - Intronic
1102466035 12:113131314-113131336 ACTGAGGCCCAGAGAGGGAAGGG - Intronic
1102724552 12:115049413-115049435 ACTGACACACAGAAGGAGAAAGG + Intergenic
1102797302 12:115699983-115700005 ACTGAGGCTCAGAAGGACAAAGG + Intergenic
1103926068 12:124423875-124423897 ATTGAGGTTCAGAGGGGGAATGG + Intronic
1103934831 12:124469648-124469670 ACTGAGGTCAGGGAGGTGAAGGG - Intronic
1103984033 12:124755268-124755290 ACTGAGGTCCAGATGGACGTGGG - Intergenic
1105209423 13:18249089-18249111 TCTGTGGCCCAGAAGGAGAGGGG + Intergenic
1105813839 13:24016060-24016082 TCTGAGCTCCACAAGGAAAATGG + Intronic
1107526868 13:41241446-41241468 ACTCAGGTCAAGAAAAAGAACGG + Intronic
1107723217 13:43271223-43271245 ACTGATGTCCAGAAGAAGGGAGG + Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1110718316 13:78732846-78732868 CCTGAATTCCAGAGGGAGAAGGG - Intergenic
1111207937 13:85036275-85036297 AATCATGTCCAGAAGGTGAAGGG - Intergenic
1111859692 13:93686474-93686496 ACTGAGGTACAGAAGAAAACAGG - Intronic
1112645075 13:101321262-101321284 ACACAAGTCCAGAAGGAAAATGG + Intronic
1112714110 13:102164022-102164044 GCTGAGGTCAACAGGGAGAAAGG - Intronic
1113565587 13:111317822-111317844 ACAGAGGTGAAGAAGGAGCAAGG - Intronic
1114181216 14:20369503-20369525 AATGCAGCCCAGAAGGAGAATGG - Exonic
1114194540 14:20465646-20465668 ACTGAGGCCCAGGAAGAGCAAGG - Intergenic
1114318437 14:21526742-21526764 TCTGAGGGCCAGAAGAAGAGGGG + Intronic
1114826728 14:26089895-26089917 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1118839350 14:69499560-69499582 CCTGAGTCCCAGAAGGAGACTGG + Intronic
1120003114 14:79326229-79326251 ACTAAGGTCCTTAAGAAGAAAGG - Intronic
1120013155 14:79440294-79440316 ACTGAGGTATAGAAGGTAAAGGG - Intronic
1120472118 14:84938866-84938888 GCTGTGGTCAAGAAGAAGAATGG - Intergenic
1120760580 14:88281114-88281136 ACTGGAGTCCAGAGGGAAAAGGG - Intronic
1120867167 14:89305175-89305197 ACTGAGGGCCACTAGGAGATGGG + Intronic
1121947170 14:98134415-98134437 ACTGAGGCCCAGAAGGCTAATGG + Intergenic
1122039002 14:98968965-98968987 ACTGAGGCACACAGGGAGAAAGG + Intergenic
1122103964 14:99437079-99437101 ACTGAGGTCCTGAAACAGACAGG + Intronic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122409813 14:101520128-101520150 ACTGAGGTCAAGATGGAGCAGGG - Intergenic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1124027641 15:25981713-25981735 ACTGAGGTACGGAAGGAGGGAGG + Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128302529 15:66575513-66575535 ACTGAGGTCCAGAAAGGGCAAGG + Intergenic
1128577363 15:68785341-68785363 ACTGAGGCCCAGGAAGTGAAGGG + Intronic
1129250558 15:74306611-74306633 ACTGAGGTCCAGACAGGGAAGGG - Intronic
1129384037 15:75185843-75185865 ACTGAGGGGGAGATGGAGAACGG + Intergenic
1129410845 15:75349426-75349448 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1129518791 15:76172708-76172730 ACTGAGGCCAAGAAGGATGAGGG + Intronic
1129660921 15:77552486-77552508 ACTGAGGCACAGAGGGAGAAGGG - Intergenic
1129703928 15:77783885-77783907 ACTGAGGTGCAAACGGAGAAAGG - Intronic
1130015667 15:80184456-80184478 ACCATGGTCCTGAAGGAGAAGGG - Intronic
1130377396 15:83341194-83341216 ACTGAGGCCCAGCAGGGGAAGGG + Intergenic
1131062519 15:89412689-89412711 TGTGGGGTCCAGAATGAGAATGG - Intergenic
1131150138 15:90042647-90042669 ACTGAGAGACAGCAGGAGAAGGG + Intronic
1131183975 15:90259461-90259483 ACTGAGTACCTGGAGGAGAAGGG - Intronic
1131565269 15:93479771-93479793 ACTGGGGGCCAACAGGAGAAGGG - Intergenic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1133234866 16:4383037-4383059 ACCGAGGTCCAGAGGGAACAGGG - Exonic
1133576988 16:7101484-7101506 ACTGAGATTCAGAAAGAGACCGG + Intronic
1133704333 16:8338958-8338980 ACTGAAGACAAGAAGGAGAGAGG + Intergenic
1134028073 16:10969818-10969840 ACTGAGGTTCAGAAAGGGACTGG - Intronic
1134446599 16:14335967-14335989 ACTGAGGCTCAGAAGGGTAAGGG + Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137507270 16:49065267-49065289 ACTGTGGCCCAGAGAGAGAAAGG + Intergenic
1137519895 16:49183801-49183823 TCTGGGGTCCAGAGAGAGAAAGG + Intergenic
1137798594 16:51242309-51242331 ACTGAGGCCTAGAAAGAGAATGG - Intergenic
1137850607 16:51738346-51738368 ACTGAGGCCTAGAGGGAGAAAGG - Intergenic
1138288197 16:55825735-55825757 ACTGAGGCCCAGACAGGGAAGGG - Intronic
1138333077 16:56230876-56230898 ACTGAGGCCCAGAGACAGAAAGG + Intronic
1138454376 16:57112917-57112939 ACGGAGGCCCAGATGGGGAAAGG + Intronic
1138454572 16:57113960-57113982 ACTGAGGCCCAGAGGGGGATGGG - Intronic
1138513333 16:57521448-57521470 CCTGAGGTGCAGCAGGAGAGAGG - Intronic
1138513744 16:57524292-57524314 CCTGAGGTGCAGCAGGAGAGAGG + Intronic
1139526276 16:67518677-67518699 ACTGAGTTCCAGAGGGAGCAAGG - Intronic
1140408728 16:74728351-74728373 GCTGAGATCCAGAGGCAGAATGG + Intronic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1140863978 16:79043767-79043789 ACTGAGGACCAGAGAAAGAAAGG - Intronic
1141502663 16:84454638-84454660 ACTGAGGTCAAGAGGGTCAAGGG + Intronic
1141636444 16:85316552-85316574 ACTGAGGTCCACAGGGGTAAGGG + Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142219104 16:88844380-88844402 ACTTTGCTCTAGAAGGAGAAGGG + Intronic
1142794179 17:2294469-2294491 ACTGAGGTACAGAAAGTGACCGG - Intronic
1143080161 17:4375741-4375763 AATTAGGTCCCCAAGGAGAAGGG + Intergenic
1143080427 17:4377336-4377358 AATTAGGTCCCCAAGGAGAAGGG - Intergenic
1143544450 17:7588274-7588296 ACTGTAGTCCAACAGGAGAAAGG + Exonic
1143724755 17:8837336-8837358 ACTGAGGTCGGGAGGGAGAGGGG - Intronic
1144785959 17:17831729-17831751 TCTGAGGCCCAGAAGGAGACAGG + Intronic
1144830676 17:18129431-18129453 ACTGAGGTCCAGAGAGGGATGGG - Intronic
1144854407 17:18260138-18260160 ACTGATGCCCAGGTGGAGAATGG + Intergenic
1146595461 17:34164612-34164634 ACTGAGGTTCAGAGAGTGAAAGG + Intronic
1146632947 17:34483852-34483874 CCAGAGGTCCAGAGAGAGAACGG - Intergenic
1147185600 17:38711601-38711623 ACTGAGGCCCAGAAGAGGCAAGG - Intronic
1147446802 17:40479668-40479690 ACTGATGTCCAGAGGAAGTAAGG - Exonic
1147465256 17:40605914-40605936 ACTGAGGTTAAGAAAGTGAAGGG + Intergenic
1147832429 17:43306189-43306211 ACTGAGGTCCAGACAGATTAGGG - Intergenic
1147898412 17:43767557-43767579 ACTGAGGTTCAGAATGATTAAGG - Exonic
1148093083 17:45034318-45034340 ACTGAGGTCTTGCTGGAGAACGG - Exonic
1148189337 17:45667729-45667751 ACAGAGGTAGAGAAGGAGGATGG - Intergenic
1148204371 17:45770708-45770730 ACCAAGGTCCAGAGGGAGGAAGG + Intergenic
1148454086 17:47801597-47801619 ACTGAGGCTCAGGAGGTGAAAGG + Intergenic
1148568581 17:48648046-48648068 ACTGAGGCCTAAAAGGAGAAGGG - Intergenic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148946981 17:51271547-51271569 ACTGAAGTACAGAAAGAAAAAGG - Intronic
1149629661 17:58111955-58111977 AATGAGGCCCAGAGAGAGAAAGG - Intergenic
1149730962 17:58945816-58945838 GGTGAGGTCCTGAAGGGGAAGGG + Intronic
1150129314 17:62658475-62658497 ACTGAAGTCCAGAAAGGGGACGG - Intronic
1151340330 17:73466874-73466896 ACTGAGGTCCAGAGAGGGGAAGG + Intronic
1152547563 17:81009497-81009519 ACTGAGGTCCAGAAAGCGTGTGG + Intronic
1153021255 18:631230-631252 ACTGAGGTCCAGAAAGACCAAGG - Intronic
1154312965 18:13281778-13281800 ACAGAGGTCCGGGAGGAGACAGG - Intronic
1155468970 18:26170763-26170785 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1156720975 18:40069775-40069797 ACTGAGACCCAGAAAGTGAAAGG - Intergenic
1156822393 18:41388757-41388779 ACTGAGGCTCAGAAGGTTAAAGG - Intergenic
1157397534 18:47355407-47355429 ACTGAAGTTGAGAAGGATAAAGG + Intergenic
1157963265 18:52180489-52180511 GCTAAAATCCAGAAGGAGAAAGG + Intergenic
1158412517 18:57220796-57220818 ACTGAGCTCCAGGAGGAGGGAGG - Intergenic
1159038640 18:63301732-63301754 ACTGAGCTCCAGAAGGGGCGGGG + Intronic
1159508767 18:69368766-69368788 ACTGAGGTCCAAGACCAGAAGGG - Intergenic
1160702277 19:513389-513411 ACTGAGGCCCAGAGGCAGGAGGG - Intronic
1161283298 19:3456957-3456979 ACTGAGGCCCAGAGAGACAAGGG + Intronic
1161619248 19:5289708-5289730 GCTGAGGACCAAAAGGTGAATGG + Intronic
1161658485 19:5530756-5530778 ACTGAGGCACAGCGGGAGAATGG - Intergenic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162286775 19:9744618-9744640 ACTGAGGTCCAGAAATAGTCAGG - Intergenic
1162822305 19:13230322-13230344 ACAGAGGCCCAGATGGAGAGAGG + Intronic
1162939252 19:13998113-13998135 ACTGAGGCCCAGAAGAAGGTTGG - Intronic
1163221581 19:15925277-15925299 ACTGAGGTCCAGAGAGATTAGGG - Intronic
1163294139 19:16401419-16401441 ACAGAGGCCCAGGAGCAGAAGGG + Intronic
1163586059 19:18164259-18164281 ACTGAGGGCCAGCCGGAGATAGG - Intronic
1163710802 19:18845663-18845685 ACTGAGGACCACAAGGAGCAGGG - Intronic
1164767538 19:30783287-30783309 AATAAGGTCCAGAAGAAGAAAGG - Intergenic
1165794193 19:38509191-38509213 ACTGAGGTCTAGAGAGGGAAGGG - Intronic
1166198327 19:41220577-41220599 ACTGAGGGCCGGAAGGAGCTGGG + Intronic
1166202274 19:41245760-41245782 ACTGAAATCCAGAAAGAAAATGG + Intronic
1166218908 19:41353165-41353187 GCTGAGGTCCTCAGGGAGAAGGG + Exonic
1166530789 19:43542282-43542304 ACAAAGGTCCAGAAAGAGACAGG + Intergenic
1166810434 19:45511095-45511117 ACTGAGGCCCACCAGGAGGAAGG + Intronic
1167110083 19:47455180-47455202 ACTGAGTCCCAGGAAGAGAAGGG + Intronic
1167292337 19:48631076-48631098 ACTGAGGTCCAGAGGGACCCAGG + Intronic
1167347475 19:48955374-48955396 ACTGAGTCCCTGATGGAGAAAGG - Intronic
1167436460 19:49481320-49481342 ACTGGGGACCTGAAGGAGCAAGG + Intronic
1167600426 19:50451530-50451552 ACTGAGGTCCTGAGGGAAGAGGG + Intronic
1167631080 19:50626581-50626603 ACAGAGGCCCAGAAAGAGAGGGG + Intronic
1168277232 19:55284756-55284778 ACTCAGGTCCTGGAGGAGAGGGG + Intronic
1168546985 19:57260990-57261012 ACTGAGGTACAGAAAGATTAAGG + Intergenic
925329827 2:3049958-3049980 ACTGGGCCCCAGAAGGCGAAGGG + Intergenic
925659080 2:6183579-6183601 CCTGAAGTCCTGAAGGATAAAGG - Intergenic
926999895 2:18783653-18783675 CCTCAGGTCCAAGAGGAGAAAGG + Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927198316 2:20563295-20563317 ACTGAGGCCCAGAGAGGGAAGGG + Intronic
927373540 2:22385820-22385842 TCTGAGGCCCATAAAGAGAATGG - Intergenic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
927863185 2:26573233-26573255 AGTGAGCTCCAGAAGGAGGGAGG + Intronic
928267017 2:29820873-29820895 AGTCAGGAACAGAAGGAGAAGGG - Intronic
928443401 2:31312128-31312150 AAAGAGGGCCAGAAGGAGAGAGG + Intergenic
929090993 2:38217227-38217249 ACTAAGATCCAGAAGCATAAAGG - Intergenic
929907667 2:46060585-46060607 ACTGAGTTCCAGTGGGAAAAGGG + Intronic
930104973 2:47632446-47632468 ACTATGGTCCAGAATGATAACGG - Intergenic
930141397 2:47954438-47954460 TTTCAGGTCCAGAAGGAGGAGGG - Intergenic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930686333 2:54312472-54312494 ACTGAGGTACAGATGGAGGTAGG - Intergenic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932515587 2:72344927-72344949 ACAGAGGTTCAGATGGAGATGGG - Intronic
932569765 2:72932396-72932418 ACTGAAGCCCAGAGGGGGAAGGG + Intronic
933481017 2:82857326-82857348 TTTGATGTCCAGGAGGAGAAAGG + Intergenic
933773353 2:85757330-85757352 ACTGAGGCCCAGAGGAGGAAGGG - Intronic
933857283 2:86428215-86428237 GCTGAGGTGCAGAAAGAGAGAGG - Intergenic
935031741 2:99329455-99329477 ACTGACGTCCAGAGGAGGAAGGG - Intronic
935389405 2:102534765-102534787 ACTGGTGGCCAGAAGAAGAAAGG - Intergenic
936058855 2:109281502-109281524 GCTGAGGACCAGCAGGTGAAAGG - Intronic
937254731 2:120547146-120547168 ACTGAGGCCCAGAAGGAATCAGG + Intergenic
938122638 2:128644737-128644759 AATGAGGTAGAGAGGGAGAAAGG - Intergenic
938395484 2:130944368-130944390 TCAGAGTTCCAGAAGGAGAAGGG - Intronic
939484029 2:142786660-142786682 ACTGATGTCCAGTTGGAAAAGGG + Intergenic
940090910 2:149915915-149915937 ACTGAGGTCCAGAGAGGTAAAGG - Intergenic
941072593 2:160971150-160971172 ACTGAGGTCCAGAGAGAACAAGG - Intergenic
941586197 2:167362619-167362641 AATAAGGCCCAGAAGGAAAAAGG - Intergenic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
942098250 2:172554359-172554381 ACTTAGGTCCCGCAGAAGAAGGG + Intergenic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
946175363 2:217919159-217919181 ATTGAGGTCCAGAAAGAAACAGG + Intronic
946178784 2:217937738-217937760 ACTGAGGCCCAGCGAGAGAAGGG + Intronic
947533010 2:230924676-230924698 ACTGGGGACCAGAAGGAGCCTGG - Intronic
947931867 2:233971502-233971524 TCTGAGGTGCAGATGGGGAATGG + Intronic
947943013 2:234075465-234075487 CGTGAGGTCCAGGAGGAGAAGGG - Intronic
948556121 2:238812708-238812730 ACTGAGGTCTAAAAGGCCAAAGG - Intergenic
948762875 2:240203513-240203535 TGTGTGGACCAGAAGGAGAAAGG + Intergenic
948772596 2:240259157-240259179 CCTGAGGCCCTGAGGGAGAATGG + Intergenic
948911332 2:241004639-241004661 CATGAGGGCCAGAAGGAAAATGG - Intronic
1168831335 20:846783-846805 ACTGAGGCCCAGAGGGAAACTGG - Intronic
1168897400 20:1333283-1333305 ACTGAGGTCCAGAAAGGGCAGGG - Intronic
1169734977 20:8828072-8828094 AATGAAGTCAATAAGGAGAAGGG + Intronic
1170492066 20:16887059-16887081 TCTGAGGCACAGAAGGAAAAGGG - Intergenic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1170922082 20:20688629-20688651 ACTGAGGTATAGAAGTAGGAGGG - Intronic
1171290575 20:23980756-23980778 TCTGCGGCCCAGAAGGAGAGGGG + Intergenic
1171427279 20:25057126-25057148 TCTGAGGCCGAGAACGAGAACGG + Intronic
1171764201 20:29245268-29245290 ACTGAGGCCCATAATGAAAAAGG - Intergenic
1172225357 20:33301923-33301945 ATTGAGGTCCAGAGGGGGAAAGG + Intronic
1172484793 20:35291726-35291748 ACTGAGGTCCAGAGAGGGAAGGG - Intronic
1172591774 20:36122769-36122791 ACTGAGGTCCAAGAAGGGAAAGG - Intronic
1173193488 20:40894894-40894916 AATGAGGTTCAGAGGGGGAAAGG + Intergenic
1173193788 20:40896983-40897005 ACTGAGGCCCAGAAGATGGAAGG - Intergenic
1173569316 20:44066494-44066516 ACTGAGGCCCAGAAAGGGAAAGG + Intronic
1173620964 20:44435634-44435656 AGTGGGGACCAGAAGTAGAAGGG + Intergenic
1173907745 20:46641117-46641139 ACTGAGGCCCAGAAGGGGACTGG - Intronic
1173940840 20:46909821-46909843 ACTGTAGTCCAGGAGGAGAGGGG - Intronic
1173997015 20:47346208-47346230 AATGTGGTCCAGCAGGAGACGGG - Intronic
1174090513 20:48043421-48043443 ACTGAGCTCCAGAGGAAGTAGGG + Intergenic
1175717743 20:61266662-61266684 ACTGAGGTCCAGAGAAGGAAGGG - Intronic
1177345966 21:19871606-19871628 ACTGAAGTCAAGAAATAGAAAGG + Intergenic
1178420752 21:32441474-32441496 GCTGAAGTCAAGCAGGAGAATGG + Intronic
1179154369 21:38836978-38837000 ACAGAGGCCCAGAAGTAGCAGGG + Intergenic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1180243655 21:46530641-46530663 ACTGGAGTCGAGAAAGAGAAAGG + Intronic
1180595351 22:16969574-16969596 ACTGAGACCCAGAGGGAGAGGGG - Intronic
1180766846 22:18350311-18350333 TCTGCGGCCCAGAAGGAGAGGGG - Intergenic
1180779467 22:18512067-18512089 TCTGCGGCCCAGAAGGAGAGGGG + Intergenic
1180812183 22:18769388-18769410 TCTGCGGCCCAGAAGGAGAGGGG + Intergenic
1181105732 22:20574065-20574087 ACAGAGCTCCAGCAGGAGAGTGG - Intronic
1181184779 22:21095231-21095253 AGTGAGTTCTAGAAAGAGAATGG - Intergenic
1181198342 22:21203635-21203657 TCTGCGGCCCAGAAGGAGAGGGG + Intergenic
1181401403 22:22652164-22652186 TCTGCGGCCCAGAAGGAGAGGGG - Intergenic
1181703371 22:24633246-24633268 TCTGCGGCCCAGAAGGAGAGGGG - Intergenic
1181714703 22:24716124-24716146 ACTGAAGTCCAGTAGCAGCATGG - Intergenic
1181985548 22:26797888-26797910 ACTGAGCTTCAGATGGAGCAGGG + Intergenic
1182100476 22:27654345-27654367 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
1182430648 22:30297070-30297092 ACTGAGGGCCAGAGAGGGAAAGG - Intronic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1182680472 22:32075454-32075476 ACTGAGGTCCAGACAGGGGAAGG + Intronic
1183340944 22:37281077-37281099 ACGGAGGACCACAAGGAGATAGG - Intergenic
1183382273 22:37496142-37496164 ACTTAGGTCCAGAGGGGGCAGGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184028674 22:41877761-41877783 ACTCAGCTCCATAATGAGAAGGG + Intronic
1184043350 22:41957532-41957554 ACTGAGGTCCAGGAGAGCAAGGG - Intergenic
1184092635 22:42300511-42300533 ACTGAGGCCCAGGAAGGGAAAGG + Intronic
1184495337 22:44837881-44837903 ACTGAGGTCCCCAAAGAGGAGGG - Intronic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
1184556100 22:45233905-45233927 TCAGAGGTCCAGAGGGACAAGGG + Intronic
1185116077 22:48939064-48939086 ACTAAGGCCCAGGAGGAAAAAGG + Intergenic
1203228465 22_KI270731v1_random:91202-91224 TCTGCGGCCCAGAAGGAGAGGGG - Intergenic
949424952 3:3906776-3906798 ACAGAGGCTAAGAAGGAGAAGGG + Intronic
949559551 3:5188585-5188607 ACTGAGGTCCAGGACCAGAAGGG + Intronic
950370755 3:12528019-12528041 ACTGAGGACCTGAAGAAGATGGG - Intronic
950582730 3:13873159-13873181 ACAGAGGCCCAGAGAGAGAATGG - Intronic
951987843 3:28640681-28640703 ACTGAGGTTCAGAAACAGAGAGG - Intergenic
952210186 3:31222472-31222494 ACTGTGGTGCAGAAGGAGGGAGG - Intergenic
952741185 3:36736642-36736664 ACTAAGGTCCAGCAAGATAAAGG + Intronic
953634879 3:44654389-44654411 ATGGAGGTCCAGAGAGAGAAGGG - Intronic
953884896 3:46709656-46709678 AATGAGGCCAAGAAGAAGAAAGG + Exonic
953927300 3:46989008-46989030 ACTGTGGGCCAGAGGGAGAGGGG + Intronic
954318246 3:49812921-49812943 ACTGGGGACCAGAATCAGAAAGG + Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
956047755 3:65214546-65214568 GATGAGGCACAGAAGGAGAAAGG + Intergenic
957673736 3:83339801-83339823 ACCGAGGGCTAGGAGGAGAAGGG + Intergenic
958115451 3:89210434-89210456 ACTGCAGTACAGAAGGCGAATGG + Exonic
961183638 3:124895896-124895918 ACTGAGGTCCAGAGGGTGGCAGG - Intronic
961394762 3:126578983-126579005 ACTGAGGGTCAGGAGGTGAAGGG - Intronic
962313106 3:134339715-134339737 ACTCAGGTGGAGAAGGAGACAGG - Intergenic
962825488 3:139096623-139096645 ACTGGGGCCCAGAAAGAGGAAGG - Intronic
962842651 3:139249924-139249946 ACTGAATTCCAGAAAGAGAAAGG - Intronic
962843917 3:139258937-139258959 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
967066429 3:185921217-185921239 ACTCATGTCCAGAAAGATAAGGG - Intronic
967197299 3:187039516-187039538 ACTGACCTTCAGAAGCAGAAAGG + Intronic
967263980 3:187673799-187673821 ATTGAGGTCCAGAGTGAGAAAGG - Intergenic
967730584 3:192903311-192903333 ACTGAGGGCCAAAAAGAAAAGGG - Intronic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
968912035 4:3481310-3481332 ATTGAGGTCCAGAAGATGGAGGG + Intronic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969632379 4:8346227-8346249 ACTGAGGCCCAGAAAGAGCCAGG - Intergenic
970403930 4:15744072-15744094 ACAGAGGCCCAGAAGGTGAAGGG - Intergenic
970470737 4:16376989-16377011 AATGAGTTCCAAAGGGAGAAAGG + Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
971915184 4:32860904-32860926 ACTGAGGTCCAGATGGCCCAAGG - Intergenic
972070343 4:35011655-35011677 AGAGAGGTACAGAAGAAGAAAGG - Intergenic
973545164 4:51973634-51973656 ACTGAGTTCCCGGAGCAGAAGGG - Intergenic
975038343 4:69712149-69712171 ACTGAGGTCTAGGAGAAGGAAGG + Intergenic
975190886 4:71460726-71460748 ACTGATATTCTGAAGGAGAAGGG + Intronic
975570705 4:75815074-75815096 ACTGTGGTGAAGATGGAGAATGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
978416085 4:108477523-108477545 ACTCAAGTCCATAATGAGAATGG + Intergenic
982824123 4:159980433-159980455 ACTGAGGTCGAAAAGGCCAAGGG + Intergenic
985012783 4:185601225-185601247 ACTGAGGACCAAGAAGAGAATGG - Intronic
986917942 5:12647582-12647604 TCTCAGGTCCAGAAGAAGCAGGG + Intergenic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
987244464 5:16034571-16034593 AGTGAGGTCCAGGAGGCTAAAGG + Intergenic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
991617578 5:68513198-68513220 ACTGAGGTCCAGATGGTGTATGG - Intergenic
991941562 5:71857996-71858018 ACAGAGTTCAAGAAAGAGAAGGG - Intergenic
992516506 5:77499299-77499321 ACTGTGGTGCAGAAAGAGAAAGG + Intronic
992834749 5:80629127-80629149 TCTGATGTCCAGGAGGAGAAAGG - Exonic
992997801 5:82349539-82349561 ACTGAGGGAAAGAAGGAGAATGG + Intronic
993325510 5:86530549-86530571 ACTGAGGTCCAGATAGATGAAGG - Intergenic
993946093 5:94118295-94118317 ACTGAGTTCCATATGGACAATGG - Intergenic
994690830 5:103017696-103017718 GCTTAGTTCCAGAAGGAGAGAGG + Intronic
994724044 5:103413787-103413809 ACTGAAGTCCAGGAGTGGAAAGG + Intergenic
997783556 5:136685078-136685100 CCTGAGTTCCAGAAGAAAAATGG + Intergenic
997835635 5:137190833-137190855 ACTGAGGTCAAGATGGAGCAGGG + Intronic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998131359 5:139652994-139653016 ACGGAGATACAGAAAGAGAAAGG - Intronic
999014991 5:148092970-148092992 ACTGTGGTTCCAAAGGAGAAGGG + Intronic
999098673 5:149004560-149004582 AATGAAGTCCAGGAGGAGAAGGG - Intronic
999303889 5:150507707-150507729 ACTGAGGTCTGGAGGGGGAAGGG + Intronic
999443002 5:151616970-151616992 ACTGAGGCCCAGAGAGGGAAAGG - Intergenic
999446821 5:151646739-151646761 AATGGGGTCCTGAAGGGGAAGGG - Intergenic
999575076 5:152967106-152967128 ACTGAAGTCCAAAAAGAGAATGG + Intergenic
999710525 5:154314428-154314450 ACTGAGGTCTAGAATGAGGAGGG - Intronic
999869595 5:155735482-155735504 ACTGAGGCTCAGAGGGGGAAAGG + Intergenic
1000111521 5:158112545-158112567 ACAGAGGTCCGGAAGCTGAAAGG + Intergenic
1000147804 5:158470248-158470270 ACTGAGGCCCAGATGGGGATGGG - Intergenic
1001772749 5:174308266-174308288 ACTGAGGCCCAGAGAGAGAGAGG + Intergenic
1002048099 5:176553301-176553323 ACTGACGTCCAAGAGGGGAAAGG - Intronic
1002139539 5:177130655-177130677 ACTGAGGGCCAAAAGGAGATTGG - Intergenic
1004022369 6:11787307-11787329 ACTGAATTCCGGAAGGAGAGAGG - Intronic
1004211052 6:13644562-13644584 TCGGAGATCGAGAAGGAGAATGG - Exonic
1004242434 6:13936938-13936960 AGTGAGGTCGAGGAGGAGAAAGG + Intronic
1004478836 6:15999820-15999842 ACTGAGACTCAGAAGGATAAAGG + Intergenic
1004849278 6:19680375-19680397 TATGAAGTCCAGAAGGATAAAGG + Intergenic
1005350377 6:24928553-24928575 AATGAAGTCAAGAGGGAGAAGGG + Intronic
1005704980 6:28442586-28442608 ACTGAGGTACAAAAGAAGGACGG + Intronic
1005981713 6:30841756-30841778 ACTGAGGTGGAAAGGGAGAAAGG - Intergenic
1006046562 6:31303882-31303904 AATGAGGTGGAAAAGGAGAAAGG + Intronic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1006718698 6:36136368-36136390 ACTGAGGCCCAGAAGGGGAAGGG + Intronic
1007103407 6:39267232-39267254 ACTGAGACCCAGAGAGAGAAGGG + Intergenic
1007254339 6:40518111-40518133 ACTGAGGCCCAGAGGGAGCTAGG - Intronic
1007398655 6:41591335-41591357 ACTGGGGCCCAGAAGGTGGAAGG - Intronic
1007707287 6:43798632-43798654 ACTGAGGCCCCAAAAGAGAAGGG + Intergenic
1008871397 6:56276566-56276588 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1011242935 6:85291321-85291343 AATGAGGTCAAGATGGAGAATGG + Intergenic
1011290461 6:85771779-85771801 ACTGAGGAGCATAAGGTGAAAGG + Intergenic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1013309484 6:108879913-108879935 AGTGAGGGCTAGAAGGAGATGGG - Intronic
1013863558 6:114665405-114665427 ACTGAGGGCCAAAAGCAGATGGG - Intergenic
1014904070 6:127004936-127004958 ACTGAGCACCAGATGGAAAATGG + Intergenic
1015554992 6:134451854-134451876 AGTGAAGTCCAGAAGGACAATGG - Intergenic
1015867112 6:137738821-137738843 ACTGAGATCCAGAAGGGTTAGGG + Intergenic
1016024445 6:139271908-139271930 CCTGAGGTCCAGAAGAACCAGGG - Intronic
1016051659 6:139536436-139536458 ACTGAGGTCCAGAGGTGGGAAGG - Intergenic
1016646227 6:146411613-146411635 CCTGAGCTCCAGGAGGAGACTGG + Intronic
1017074862 6:150608331-150608353 CCTGAGGAACAGAAGGAGACTGG + Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018954209 6:168397156-168397178 ACAGAGCTCCAGAAGGAGTGCGG + Intergenic
1019267383 7:125453-125475 ACTGAGGCCCAGAGGGAGAAGGG + Intergenic
1019283463 7:211761-211783 ACTGAGGCCCGGAAAGGGAAAGG + Intronic
1020699345 7:11459220-11459242 ATTGAGGTCCAGAAGGTGAAGGG + Intronic
1022248749 7:28586172-28586194 AGTGAGGACCACAAGGAGCATGG - Intronic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1022891492 7:34704809-34704831 ACTTAGGACCAATAGGAGAAAGG - Intronic
1023475279 7:40571048-40571070 ACTGAGGCCCAGAAAGAAAGTGG - Intronic
1023887768 7:44373484-44373506 ACCAGGGTCCAGAGGGAGAATGG - Intergenic
1024325632 7:48107273-48107295 ACTGATGCCCAGAAGGACACAGG - Intronic
1026978866 7:74515156-74515178 ACTGAGGCTCAGAGAGAGAAGGG + Intronic
1027394155 7:77736481-77736503 AATGAGATCAAGAAAGAGAATGG + Exonic
1027606091 7:80300697-80300719 ACTTATGTCAAGAAAGAGAAAGG + Intergenic
1027941410 7:84685723-84685745 ACTGGAGTGGAGAAGGAGAATGG + Intergenic
1029482072 7:100819486-100819508 ACTGAGGGCCTGAAGGGGAGAGG - Intronic
1030060692 7:105618640-105618662 ACTGAGGTCCAGTAGAGGCAAGG - Intronic
1030093995 7:105881605-105881627 CCTGAGGTTCAGAAGGATCAAGG - Intronic
1030105363 7:105982549-105982571 ACTGAGGGGGAGAAGGGGAAAGG - Intronic
1030397027 7:108998815-108998837 ACTGGGGTTTAGAAAGAGAAAGG - Intergenic
1032019451 7:128398891-128398913 ACTGTGGCCCAGCAGGTGAAAGG - Intronic
1032526764 7:132583708-132583730 AAATAGGGCCAGAAGGAGAATGG - Intronic
1032946905 7:136864703-136864725 ACTGAGGTCAAGGAAAAGAAAGG + Intergenic
1035626588 8:1075654-1075676 ACAAAGGACCTGAAGGAGAAGGG - Intergenic
1036434583 8:8722031-8722053 ACTGAAGTCCAGAGAGAGGAAGG - Intergenic
1036459091 8:8936180-8936202 AGTGAGGACCCGAAGGGGAAGGG - Intergenic
1036559083 8:9886188-9886210 ACTGAGCTCCAGGATGAGCATGG - Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1036816270 8:11905231-11905253 ACTGAGGTGCAGGATGAAAATGG + Intergenic
1037430085 8:18802674-18802696 ACTGAGGTCTGGGAGGTGAAGGG - Intronic
1037659334 8:20913551-20913573 ACTGAGGCCCAAGAGGAAAATGG + Intergenic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1038251658 8:25910779-25910801 ACTGGGTTCACGAAGGAGAAGGG + Intronic
1038416560 8:27400703-27400725 ATTGAGATCCAGACAGAGAAAGG + Intronic
1039411662 8:37360078-37360100 ACTGAGGTCCAGAGAGGGGAAGG - Intergenic
1039834657 8:41246900-41246922 AGTGAGGTGCAGAAGCAGCAGGG - Intergenic
1040976364 8:53198274-53198296 GCTGAAGTCCAGAAGGTCAACGG + Intergenic
1041994611 8:64038876-64038898 ACAGAGGACAAGGAGGAGAAGGG - Intergenic
1043323747 8:79024311-79024333 AAGGTGGTCCTGAAGGAGAAAGG + Intergenic
1044011473 8:86999225-86999247 CTTGGGGTCCAGAAGGAGAGTGG + Intronic
1044810137 8:96052412-96052434 ACTGAAGACTAGAAAGAGAAAGG + Intergenic
1045476814 8:102560134-102560156 ACTGAGGTACAGAAGGGTTAAGG + Intronic
1045729162 8:105215193-105215215 ACAGAGCTCCAGTAGGAGACTGG - Intronic
1045906843 8:107355830-107355852 AGTGTGCTCCAGAAGTAGAAAGG - Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046767102 8:118081656-118081678 ACTGAGTCCCAGGAGGAGATGGG + Intronic
1047354589 8:124108478-124108500 CCTGGGGCCCAGAAGGAGATGGG - Intronic
1048510222 8:135055175-135055197 ACTGAGGGCTGGAAGGGGAAAGG + Intergenic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1048955401 8:139531924-139531946 ACTAAGGTGGAGAAGGAGAAAGG + Intergenic
1049204088 8:141355319-141355341 ACTGAGGCTCAGAGGGAGAAAGG - Intergenic
1049223882 8:141440552-141440574 ACTGAGCCCCAGAAAGGGAAAGG + Intergenic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1050010823 9:1184411-1184433 TCTGAGGTGCAGAGAGAGAAGGG - Intergenic
1050285264 9:4095244-4095266 ATTTATGTCCAGAAGTAGAAAGG - Intronic
1051805653 9:20990184-20990206 ACTGAGGCCGAGGAGGAGAGGGG - Exonic
1052171047 9:25396938-25396960 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1052984736 9:34478589-34478611 ACTGAAGTCCACAACAAGAATGG + Intronic
1053198927 9:36139628-36139650 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1053307206 9:36993532-36993554 ACTGAGGCCCAGACAGAGAAAGG + Intronic
1053416135 9:37947908-37947930 ACTGAGGTCCAGAAAAAGAAGGG - Intronic
1053416996 9:37953112-37953134 CCAGAGGCCCAGAAGGAGAGTGG + Intronic
1053434720 9:38067512-38067534 ACTGAGGTCCAGAGCAAGGAAGG - Intronic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1053529174 9:38861427-38861449 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054201399 9:62085856-62085878 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054636960 9:67502504-67502526 TGAGAGTTCCAGAAGGAGAAGGG - Intergenic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1058145882 9:101410889-101410911 ACTGAGGTACAGGAGAAGGAGGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058652631 9:107190902-107190924 AATGAGGTCAGGAAGGAGACTGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059334476 9:113560247-113560269 ACTGAGATCAGGAAGGGGAACGG + Intronic
1059451095 9:114371924-114371946 ACAGAGGTCCAGATGGAGTGAGG + Intronic
1059672808 9:116507552-116507574 ATTGTGGTCCAGAGGGAGGATGG - Intronic
1059773144 9:117446819-117446841 ACTGAGGACCAGAAAGGGAAAGG - Intergenic
1060202920 9:121662292-121662314 ATTCAGGTCCAGAAGGAGTCAGG + Intronic
1060358173 9:122930633-122930655 ACCGAGGTCCAGATGGTGAATGG - Intronic
1060497444 9:124129005-124129027 ACTGAGGTCCGGAGAGAGAAAGG + Intergenic
1060737234 9:126073758-126073780 ACTGAGGACCAGAGGGAGAAGGG + Intergenic
1060785855 9:126451188-126451210 GCTGAGGCCCAGATGGTGAAGGG - Intronic
1060965285 9:127709018-127709040 ACTGAGGCTCAGAAGGATAAAGG - Intronic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061407828 9:130402559-130402581 ACTGAGGTCCAGAGAGTGGAAGG + Intronic
1061419066 9:130463524-130463546 ACTGAGGCCCAGGAAGGGAAAGG - Intronic
1061422562 9:130480177-130480199 ACTGAGGCCCAGAGAGAGCAGGG - Intronic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061871731 9:133524518-133524540 ACTGAGGTCCAGATAGGGGAAGG + Intronic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1062362530 9:136194430-136194452 ACTGAGGCCCAGAGGAGGAAAGG - Intergenic
1203773176 EBV:59578-59600 TCTGAGGAGGAGAAGGAGAATGG + Intergenic
1186374142 X:8980556-8980578 ACTGAGGTGCAGCCGGAGACTGG - Intergenic
1186446696 X:9635804-9635826 ACTCAGGTAAAGAAGGATAAAGG + Intronic
1187414999 X:19085899-19085921 ACTGAGGTAGAGCAGGCGAAGGG - Intronic
1188993322 X:36851370-36851392 ACTGAGATGCAGAAGAATAAAGG - Intergenic
1189578902 X:42384833-42384855 ACTGTTACCCAGAAGGAGAAAGG - Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190517343 X:51237289-51237311 TTAGAGTTCCAGAAGGAGAAGGG + Intergenic
1190639322 X:52467339-52467361 ACTGAGGTCTTCAGGGAGAAAGG + Intergenic
1190699786 X:52979215-52979237 ACTGAGGCCTTCAAGGAGAAAGG - Intronic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1191127048 X:56968110-56968132 ACTGACAACCAGAAGGAAAATGG + Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191842715 X:65524584-65524606 ACTGAGGTCCAGAGAGGGGAAGG - Exonic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192049627 X:67712212-67712234 ATTGAGACCCAGAAGGGGAAGGG - Intronic
1192151700 X:68716767-68716789 ACTGAGGCCCAGAAGGGAAGAGG - Intronic
1192226755 X:69233983-69234005 ACTGAGGCCCAGAAAGGGAAAGG - Intergenic
1192362479 X:70448469-70448491 ACTGTGGTTCAGAAGGGGAAGGG + Intronic
1192554539 X:72079455-72079477 ACTGAGGCTCAGAAAGGGAAAGG - Intergenic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1192925163 X:75748205-75748227 ACTGAGGCTCAGAAGTGGAAAGG - Intergenic
1192947880 X:75985340-75985362 ACTGAGGCTCAGAAGTGGAAAGG - Intergenic
1193693926 X:84682506-84682528 GCTGGGGGCCAGAAGGAAAAGGG + Intergenic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195402248 X:104473487-104473509 AATCAGCTCCAGAAGAAGAAAGG + Intergenic
1195431238 X:104791770-104791792 ACTGAGGTTCAGTAAGAGGAAGG - Intronic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1196345078 X:114645536-114645558 ACTGATTTCCAGAAGCATAAAGG + Intronic
1196989280 X:121310106-121310128 ATTATGGTCCAGCAGGAGAATGG - Intergenic
1197296121 X:124721099-124721121 AATGAGGTTGAGAAGAAGAAAGG + Intronic
1198018645 X:132636610-132636632 ACTGAGGCCCAGAGAGAGACAGG + Intronic
1199605357 X:149573908-149573930 AGTGAGGACCAGAGGGAGAAAGG - Intergenic
1199633764 X:149795460-149795482 AGTGAGGACCAGAGGGAGAAAGG + Intergenic
1199770049 X:150969480-150969502 ACAAAGGACCAGACGGAGAAAGG + Intergenic
1199807273 X:151312751-151312773 ACTGAGGCCCAGAAAGGGTAAGG - Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1199934138 X:152554461-152554483 ACTAAGGTTCAGAAGAACAATGG - Intergenic
1200834289 Y:7717921-7717943 ACTGAGGTCCAGAAGAGGGAAGG + Intergenic
1200895935 Y:8376133-8376155 CCTGTGGTCCAGGAGAAGAAAGG + Intergenic
1200946447 Y:8845099-8845121 ACTGGGGTCCAGAGGGTGAGGGG + Intergenic
1201263937 Y:12187727-12187749 CCTGAATTCCAAAAGGAGAAGGG - Intergenic