ID: 1122150997

View in Genome Browser
Species Human (GRCh38)
Location 14:99726226-99726248
Sequence ACTGCTGCCCGATGCAGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 139}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122150997_1122151003 -5 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151003 14:99726244-99726266 GCAGTTTGCTCAGGTAGGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 190
1122150997_1122151002 -6 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151002 14:99726243-99726265 AGCAGTTTGCTCAGGTAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 185
1122150997_1122151009 30 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151009 14:99726279-99726301 TCTGCCCAGGAGTAGCTGCAGGG 0: 1
1: 0
2: 2
3: 34
4: 219
1122150997_1122151004 -1 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151004 14:99726248-99726270 TTTGCTCAGGTAGGAGGGGCAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1122150997_1122151008 29 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151008 14:99726278-99726300 TTCTGCCCAGGAGTAGCTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 239
1122150997_1122151001 -7 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151001 14:99726242-99726264 CAGCAGTTTGCTCAGGTAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 209
1122150997_1122151005 0 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151005 14:99726249-99726271 TTGCTCAGGTAGGAGGGGCAGGG 0: 1
1: 0
2: 1
3: 35
4: 518
1122150997_1122151006 6 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151006 14:99726255-99726277 AGGTAGGAGGGGCAGGGCTGTGG 0: 1
1: 2
2: 15
3: 137
4: 1242
1122150997_1122151007 17 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151007 14:99726266-99726288 GCAGGGCTGTGGTTCTGCCCAGG 0: 1
1: 0
2: 4
3: 39
4: 346
1122150997_1122151000 -10 Left 1122150997 14:99726226-99726248 CCGCTCCTGCATCGGGCAGCAGT 0: 1
1: 1
2: 0
3: 12
4: 139
Right 1122151000 14:99726239-99726261 GGGCAGCAGTTTGCTCAGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122150997 Original CRISPR ACTGCTGCCCGATGCAGGAG CGG (reversed) Exonic
901290116 1:8117575-8117597 ACTGTTGCCTGATGCAGCAGGGG + Intergenic
901785592 1:11622479-11622501 ACAGCTGCCAAATGCAGGAAGGG + Intergenic
906519570 1:46459101-46459123 GCTGGTGGCTGATGCAGGAGCGG + Intergenic
906731814 1:48089436-48089458 ACTGCTGACCGATGCAGGAGTGG - Intergenic
909300937 1:74012425-74012447 AGTGATGCCAGATGGAGGAGAGG + Intergenic
915941471 1:160121019-160121041 ACTGCTGGGCCATGGAGGAGGGG + Intronic
917895737 1:179485043-179485065 AGTGCTGGCAGATGCAGGACTGG - Intronic
919761587 1:201101576-201101598 TCTGCTCCCAGATGCAGGAGAGG + Intronic
920956151 1:210621871-210621893 ACTGCTGCCAGACGCAAGTGTGG - Intronic
924916782 1:248578202-248578224 ACTGCTGGGGGATGAAGGAGTGG - Intergenic
1063956336 10:11271009-11271031 ATTCCTGCCTGATGTAGGAGGGG + Intronic
1063970782 10:11379970-11379992 GCTGCTGCCGGAAGCAGGAGAGG - Intergenic
1064346072 10:14533911-14533933 ACTGCGAGCCGGTGCAGGAGGGG + Intronic
1066299390 10:34083353-34083375 ACTAATGCCCAATGCATGAGGGG + Intergenic
1067062701 10:43086042-43086064 TCTGCAGCCCAATGCAGAAGGGG + Intronic
1067299171 10:44993596-44993618 ACTGCTCTCCAGTGCAGGAGAGG - Exonic
1069858391 10:71454563-71454585 ACTGCTGCCCGTGCCATGAGTGG - Intronic
1070741755 10:78907850-78907872 AAGGCTGCTCCATGCAGGAGGGG + Intergenic
1073300074 10:102465789-102465811 GCTGTTTCCCGATGGAGGAGTGG + Intronic
1073678724 10:105679143-105679165 ACTGCTGGGGGATGCAGGAGAGG - Intergenic
1079571707 11:21952076-21952098 ACTGCTGGGGGATGGAGGAGAGG - Intergenic
1080441677 11:32300156-32300178 ACTGATGTCCCCTGCAGGAGAGG + Intergenic
1084071299 11:66737590-66737612 ACTGCTGCCCAAAGCTGGAATGG + Intergenic
1087220864 11:95545074-95545096 AAAGCTGCAGGATGCAGGAGTGG - Intergenic
1088732342 11:112694360-112694382 ACTGCTGCACCATACAGGAGGGG + Intergenic
1091656126 12:2348122-2348144 CCTCCTGCCTGCTGCAGGAGTGG + Intronic
1091991625 12:4960454-4960476 ACTGCTGCCCAAGGCAGGCTTGG + Intergenic
1101981984 12:109415580-109415602 ACTCCTCCACTATGCAGGAGAGG + Exonic
1106054743 13:26227772-26227794 ACTGCTGCCCCACTCAGGGGTGG - Intergenic
1109652275 13:65344443-65344465 ACTGCTGCCTGATGCAACAGGGG + Intergenic
1111766464 13:92536468-92536490 ACTGCTTTCCAATCCAGGAGAGG - Intronic
1111924208 13:94445833-94445855 CCCGCTGCCCCATGCAGAAGTGG + Intronic
1113699496 13:112374165-112374187 ACTAATCCCAGATGCAGGAGTGG - Intergenic
1122150997 14:99726226-99726248 ACTGCTGCCCGATGCAGGAGCGG - Exonic
1123974757 15:25542758-25542780 ACTGCTTCTCCATGGAGGAGGGG - Intergenic
1124394043 15:29285139-29285161 ACTGCTCCCTGACGCTGGAGTGG + Intronic
1130326259 15:82882640-82882662 ACTGCTTCCAGAAGGAGGAGAGG + Intronic
1131571947 15:93546787-93546809 ACTGGTGCCCCATACAGAAGAGG + Intergenic
1132738044 16:1397189-1397211 ACTGCTGCTCCGTGCGGGAGTGG + Intronic
1134515767 16:14885680-14885702 ACTCCTGCCCCATCCATGAGTGG + Intronic
1134703439 16:16284324-16284346 ACTCCTGCCCCATCCATGAGGGG + Intronic
1134964104 16:18427790-18427812 ACTCCTGCCCCATCCATGAGGGG - Intronic
1134968391 16:18510326-18510348 ACTCCTGCCCCATCCATGAGGGG - Intronic
1136027902 16:27481759-27481781 ACAGCAGCCAGATGCAGCAGGGG - Intronic
1136911243 16:34146331-34146353 ACTGCTTCCGGATGCAGAAGTGG + Intergenic
1141484991 16:84333108-84333130 GCTGCTGCGGGATGAAGGAGGGG - Intergenic
1142597739 17:1037711-1037733 ATTGCAGCCTGAGGCAGGAGGGG + Intronic
1145028453 17:19486803-19486825 ACTGCTGGCAGATGCAGAGGTGG - Intergenic
1146098982 17:29960194-29960216 ACTGCTGGGGGATGGAGGAGGGG + Intronic
1146490167 17:33275281-33275303 ACTGCCACCCCATCCAGGAGAGG - Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1150361042 17:64534369-64534391 ACTGCTGCCCTCTGCTGCAGTGG + Intronic
1151712322 17:75813845-75813867 ACTGCTGCTCGGTGCGGGTGTGG - Exonic
1152376214 17:79920136-79920158 TCCCCTGCCCGCTGCAGGAGGGG - Intergenic
1156341938 18:36217631-36217653 GCTCCTGCCCTTTGCAGGAGCGG - Intronic
1157552954 18:48594087-48594109 TCTGCTGCACATTGCAGGAGTGG - Intronic
1159373372 18:67559107-67559129 ACTCCTGCCAGAAGCATGAGAGG + Intergenic
1160532466 18:79573545-79573567 ACCTGGGCCCGATGCAGGAGGGG + Intergenic
1160583495 18:79900606-79900628 GCCGCAGCCCGAAGCAGGAGGGG + Intergenic
1160803479 19:980816-980838 GCTGCTGCCACAGGCAGGAGAGG - Intergenic
1163371463 19:16903555-16903577 GCTGCTGCCTGATGCAGGTGAGG - Exonic
1163559350 19:18009766-18009788 ACTGCTCCTTGCTGCAGGAGAGG + Exonic
1163559359 19:18009830-18009852 ACGGCTGCCCGAGGCAGCACAGG - Exonic
1167006914 19:46782312-46782334 TCTGCTGCCAGAGGCAGGTGCGG - Intronic
1167146235 19:47681959-47681981 CGGGCTGCCCGTTGCAGGAGAGG + Exonic
1168421783 19:56208765-56208787 ACTGCTGCCCTTTGCATGTGAGG + Exonic
925036636 2:692254-692276 GCTGCTGCCCGAGGGAAGAGAGG - Intergenic
925314912 2:2914071-2914093 ACTGATTCCAGTTGCAGGAGAGG + Intergenic
925916610 2:8611395-8611417 ACTGCTGCCCGATTGAGGATGGG + Intergenic
926987342 2:18639304-18639326 ACAGCTGCCCTATGGAAGAGTGG - Intergenic
929756386 2:44768827-44768849 GCTGCTCCCCAATGGAGGAGCGG + Intronic
931636340 2:64343917-64343939 ACAGCTGCCGGACACAGGAGAGG - Intergenic
931695344 2:64866676-64866698 GCTTCTGCCAGATGGAGGAGTGG - Intergenic
932028390 2:68158033-68158055 ACAGCTGTCCGCAGCAGGAGAGG + Exonic
941649613 2:168079536-168079558 ACTGATGCCCCATCTAGGAGTGG - Intronic
946004620 2:216512993-216513015 ACTGCTGCCCTTTGCATGATGGG - Intronic
946166435 2:217866905-217866927 CCTGCTGCCCCATGCAGTTGGGG - Intronic
947017469 2:225637382-225637404 ACAGCTGCCCGGTGCTGAAGTGG - Intronic
947534052 2:230929803-230929825 CCTGCTGCCAAATGCAGGGGAGG + Intronic
948320010 2:237061523-237061545 ACTGCTCCCGGGTGCAGGATGGG - Intergenic
948563509 2:238868996-238869018 TCTGCTGCCTGATGCTGGTGCGG - Intronic
948668865 2:239553626-239553648 AGTGCTCCCAGAGGCAGGAGAGG - Intergenic
948704211 2:239779134-239779156 ACAGCGGACAGATGCAGGAGGGG + Intronic
948726931 2:239939857-239939879 ACTGCAGCCGGTTCCAGGAGGGG - Intronic
948836864 2:240630086-240630108 TCTGCTGCCGCATGCAGCAGTGG + Exonic
1171372326 20:24669823-24669845 ACAGCTGCCCCATGCACAAGGGG + Intergenic
1171906587 20:30904598-30904620 ACTGCTTCCGGATGTAGAAGTGG + Intergenic
1172117184 20:32579963-32579985 GCTGCTGCCTGAGGCAGGACTGG - Intronic
1173181954 20:40812544-40812566 GCTGCTGCCCCACTCAGGAGGGG - Intergenic
1175589075 20:60172924-60172946 CCTGCTGCCCACTGGAGGAGAGG - Intergenic
1175696408 20:61106137-61106159 CCTTCTGCCCACTGCAGGAGGGG + Intergenic
1178422980 21:32456990-32457012 ACTGCTCCCCGAGGGAGAAGTGG + Intronic
1179457415 21:41508593-41508615 ACTGCTGGCCCAAGCACGAGTGG + Intronic
1180340000 22:11610692-11610714 ACTGCTTCCGGATGTAGAAGTGG + Intergenic
1180902556 22:19385348-19385370 ACTGCTGCATGATGCAGTAATGG - Intronic
1181351320 22:22260499-22260521 ACTGGGGCCTGTTGCAGGAGGGG + Intergenic
1183373880 22:37450935-37450957 AGTGCTCCCAGAAGCAGGAGTGG - Intergenic
1184016103 22:41786777-41786799 ACTGCTACCAGAAGAAGGAGGGG + Intronic
1184340655 22:43884143-43884165 ACTGGTGCCCATGGCAGGAGGGG - Intronic
1184880558 22:47301854-47301876 ACTGCTGCCCACTGCAGAAGGGG - Intergenic
1184906936 22:47494503-47494525 ACTGCTGCCTGATTCAAGGGAGG - Intergenic
949925540 3:9038010-9038032 TCTGCTGCCCGAGGTGGGAGTGG - Intronic
950218228 3:11174902-11174924 AATGTTGCCCGGGGCAGGAGTGG - Intronic
952706277 3:36380720-36380742 GCTGCTGGTGGATGCAGGAGAGG - Exonic
953920357 3:46947357-46947379 ACTGCAGCCCCATGCCGGGGTGG + Intronic
956678643 3:71757614-71757636 GCTGCTGCCCAAAGCTGGAGTGG - Intergenic
961079898 3:124017446-124017468 AATGCTCCCCAATCCAGGAGTGG + Intergenic
962938526 3:140104243-140104265 CCTGCTGCTCTATGAAGGAGAGG - Intronic
966449286 3:180039275-180039297 GCTGCTGCCTGATGCATGAATGG - Intergenic
967858901 3:194137345-194137367 ACTCCTTCCCGTTGCAGAAGGGG + Intronic
968804326 4:2762744-2762766 AAGGCTGCCCGAGCCAGGAGCGG - Intergenic
968946531 4:3667434-3667456 TCTGCTGGCCGACGCATGAGAGG + Intergenic
969494980 4:7521343-7521365 AGTGCAGCCCGGTGCCGGAGGGG - Intronic
970482201 4:16487683-16487705 ACTGTTGCTCCCTGCAGGAGAGG - Intergenic
971819182 4:31530105-31530127 ACAGCTGCCCTATGGAGAAGAGG - Intergenic
973227392 4:47801944-47801966 ACTGCTGGAGGATGAAGGAGAGG - Intronic
980244126 4:130216256-130216278 ACAGCTGCAAGATGCATGAGTGG - Intergenic
983271281 4:165564861-165564883 AGTGCAGCCCAATGCAGTAGGGG - Intergenic
987374044 5:17217905-17217927 CCTGCTGCCCGCTGCATGAAGGG - Intronic
990250764 5:53912610-53912632 AGTGCTGCCCTTTGGAGGAGGGG - Intronic
990983475 5:61621572-61621594 ACTGCTGCCAGATGCAGAGCTGG + Intergenic
993164856 5:84339261-84339283 ACTACTGCCCTATGAAGTAGAGG - Intronic
995457620 5:112368699-112368721 AATGATGCCAGATGCAGCAGAGG - Intronic
995988397 5:118208028-118208050 ACAGGAGCCCAATGCAGGAGGGG + Intergenic
998080771 5:139273564-139273586 ACTGCTGACCTCTGCAGGACCGG - Intronic
1000698775 5:164422116-164422138 ACAGCTGCCCTAAGGAGGAGAGG - Intergenic
1002569507 5:180132175-180132197 GCTTCAGCCCGAGGCAGGAGGGG - Intronic
1006885211 6:37375961-37375983 ACTGCAGGCCTCTGCAGGAGTGG + Intronic
1007181812 6:39934249-39934271 ACAGCTTCCCGGGGCAGGAGTGG - Intronic
1013366741 6:109442820-109442842 GCTGCTGCCTGCTGAAGGAGTGG + Exonic
1019504836 7:1385620-1385642 ACTGAGGCCTGAGGCAGGAGGGG - Intergenic
1019601427 7:1885712-1885734 ACTGCTGCCCCGTGGAGCAGAGG + Intronic
1029575945 7:101403295-101403317 AATGCTCCCCCATGAAGGAGGGG - Intronic
1035203716 7:157281618-157281640 ACTCCTGCCCGAGGCACCAGAGG + Intergenic
1053446371 9:38156278-38156300 CCTCCTGCAAGATGCAGGAGAGG + Intergenic
1057423860 9:94933173-94933195 ACTGCTGCACGAGTCAGGAGGGG - Intronic
1060996311 9:127876499-127876521 CCTGCTGCCCCAGGCAGGAGTGG + Intronic
1061083138 9:128384200-128384222 GCTGCTGCTCTATGCTGGAGTGG - Intronic
1187265855 X:17732325-17732347 GCTGCTGCTGGCTGCAGGAGGGG - Exonic
1187656280 X:21478318-21478340 ACTGATGCCTCATGCAGGAAAGG + Intronic
1187978321 X:24727362-24727384 ACTGCTGACCTTTGAAGGAGAGG + Intronic
1190172370 X:48121793-48121815 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190197132 X:48329228-48329250 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190204830 X:48394473-48394495 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190205706 X:48400930-48400952 ACAGCTGGCAGGTGCAGGAGGGG - Intergenic
1190658656 X:52635039-52635061 ACAGCTGGCAGGTGCAGGAGGGG + Intergenic
1190659660 X:52642817-52642839 ACAGCTGGCAGGTGCAGGAGGGG - Intergenic
1190663871 X:52679606-52679628 ACAGCTGGCAGGTGCAGGAGGGG + Intronic
1190665887 X:52695653-52695675 ACAGCTGGCAGGTGCAGGAGGGG - Intronic
1190673531 X:52762757-52762779 ACAGCTGGCAGGTGCAGGAGGGG + Intronic
1190675551 X:52778816-52778838 ACAGCTGGCAGGTGCAGGAGGGG - Intronic
1192923891 X:75735528-75735550 ACTGCTTCCCTAGGCAGGGGAGG + Intergenic
1196677399 X:118434628-118434650 GGTGCTGCCCCATGCAGGAATGG + Intronic