ID: 1122152211

View in Genome Browser
Species Human (GRCh38)
Location 14:99731350-99731372
Sequence CCCCCAGTGACTGCCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122152211_1122152224 14 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152224 14:99731387-99731409 GGAAGGGGACTCACAGTGGGAGG No data
1122152211_1122152226 18 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152226 14:99731391-99731413 GGGGACTCACAGTGGGAGGGAGG No data
1122152211_1122152227 19 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152227 14:99731392-99731414 GGGACTCACAGTGGGAGGGAGGG No data
1122152211_1122152219 -3 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152219 14:99731370-99731392 GGGTATTTCTGGCAGACGGAAGG No data
1122152211_1122152218 -7 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152218 14:99731366-99731388 CTGGGGGTATTTCTGGCAGACGG No data
1122152211_1122152221 -1 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152221 14:99731372-99731394 GTATTTCTGGCAGACGGAAGGGG No data
1122152211_1122152223 11 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152223 14:99731384-99731406 GACGGAAGGGGACTCACAGTGGG No data
1122152211_1122152222 10 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152222 14:99731383-99731405 AGACGGAAGGGGACTCACAGTGG No data
1122152211_1122152225 15 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152225 14:99731388-99731410 GAAGGGGACTCACAGTGGGAGGG No data
1122152211_1122152220 -2 Left 1122152211 14:99731350-99731372 CCCTCCCCGGCAGTCACTGGGGG No data
Right 1122152220 14:99731371-99731393 GGTATTTCTGGCAGACGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122152211 Original CRISPR CCCCCAGTGACTGCCGGGGA GGG (reversed) Intergenic
No off target data available for this crispr